ID: 937994129

View in Genome Browser
Species Human (GRCh38)
Location 2:127680168-127680190
Sequence CGGGAGGGCTCCGGCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937994129_937994144 14 Left 937994129 2:127680168-127680190 CCTGCACAGCCGGAGCCCTCCCG No data
Right 937994144 2:127680205-127680227 CCAAAGGAAGAATAGTGAGCAGG No data
937994129_937994135 -9 Left 937994129 2:127680168-127680190 CCTGCACAGCCGGAGCCCTCCCG No data
Right 937994135 2:127680182-127680204 GCCCTCCCGGGCGGCTCCCTGGG No data
937994129_937994140 -2 Left 937994129 2:127680168-127680190 CCTGCACAGCCGGAGCCCTCCCG No data
Right 937994140 2:127680189-127680211 CGGGCGGCTCCCTGGGCCAAAGG No data
937994129_937994134 -10 Left 937994129 2:127680168-127680190 CCTGCACAGCCGGAGCCCTCCCG No data
Right 937994134 2:127680181-127680203 AGCCCTCCCGGGCGGCTCCCTGG No data
937994129_937994145 27 Left 937994129 2:127680168-127680190 CCTGCACAGCCGGAGCCCTCCCG No data
Right 937994145 2:127680218-127680240 AGTGAGCAGGACACCGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937994129 Original CRISPR CGGGAGGGCTCCGGCTGTGC AGG (reversed) Intronic
No off target data available for this crispr