ID: 937994422 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:127681739-127681761 |
| Sequence | TGAACATCAGGCTACTCGGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 79 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 75} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937994422_937994428 | 29 | Left | 937994422 | 2:127681739-127681761 | CCGGCCGAGTAGCCTGATGTTCA | 0: 1 1: 0 2: 0 3: 3 4: 75 |
||
| Right | 937994428 | 2:127681791-127681813 | CCCCACAGTGAAAAGAATCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937994422 | Original CRISPR | TGAACATCAGGCTACTCGGC CGG (reversed) | Intronic | ||