ID: 937994428

View in Genome Browser
Species Human (GRCh38)
Location 2:127681791-127681813
Sequence CCCCACAGTGAAAAGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937994424_937994428 17 Left 937994424 2:127681751-127681773 CCTGATGTTCACAGTATCCACGG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 937994428 2:127681791-127681813 CCCCACAGTGAAAAGAATCCTGG No data
937994423_937994428 25 Left 937994423 2:127681743-127681765 CCGAGTAGCCTGATGTTCACAGT 0: 1
1: 0
2: 0
3: 9
4: 117
Right 937994428 2:127681791-127681813 CCCCACAGTGAAAAGAATCCTGG No data
937994421_937994428 30 Left 937994421 2:127681738-127681760 CCCGGCCGAGTAGCCTGATGTTC 0: 1
1: 0
2: 0
3: 0
4: 45
Right 937994428 2:127681791-127681813 CCCCACAGTGAAAAGAATCCTGG No data
937994426_937994428 0 Left 937994426 2:127681768-127681790 CCACGGACAGACTGCAAAAGAAG 0: 1
1: 0
2: 0
3: 4
4: 138
Right 937994428 2:127681791-127681813 CCCCACAGTGAAAAGAATCCTGG No data
937994422_937994428 29 Left 937994422 2:127681739-127681761 CCGGCCGAGTAGCCTGATGTTCA 0: 1
1: 0
2: 0
3: 3
4: 75
Right 937994428 2:127681791-127681813 CCCCACAGTGAAAAGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937994428 Original CRISPR CCCCACAGTGAAAAGAATCC TGG Intergenic