ID: 937995149

View in Genome Browser
Species Human (GRCh38)
Location 2:127688669-127688691
Sequence ATGTCTCATCAGAAGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937995149_937995152 4 Left 937995149 2:127688669-127688691 CCCCATTGCTTCTGATGAGACAT No data
Right 937995152 2:127688696-127688718 TGTCAATATTATTGTACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937995149 Original CRISPR ATGTCTCATCAGAAGCAATG GGG (reversed) Intergenic
No off target data available for this crispr