ID: 937996467

View in Genome Browser
Species Human (GRCh38)
Location 2:127698271-127698293
Sequence CACTGTGAATGGAGCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937996464_937996467 -10 Left 937996464 2:127698258-127698280 CCACATCAACGTCCACTGTGAAT No data
Right 937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG No data
937996462_937996467 5 Left 937996462 2:127698243-127698265 CCTTTGCATCTCCATCCACATCA No data
Right 937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG No data
937996463_937996467 -6 Left 937996463 2:127698254-127698276 CCATCCACATCAACGTCCACTGT No data
Right 937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937996467 Original CRISPR CACTGTGAATGGAGCCCAGA AGG Intergenic
No off target data available for this crispr