ID: 937997912

View in Genome Browser
Species Human (GRCh38)
Location 2:127708928-127708950
Sequence CAGTGTGACCAGAAGTAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937997906_937997912 19 Left 937997906 2:127708886-127708908 CCTGGCCCTGAAACAAGAAACAA 0: 1
1: 0
2: 3
3: 34
4: 380
Right 937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG 0: 1
1: 0
2: 0
3: 8
4: 126
937997910_937997912 -8 Left 937997910 2:127708913-127708935 CCTTACAGGAAAGCACAGTGTGA 0: 1
1: 0
2: 4
3: 17
4: 171
Right 937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG 0: 1
1: 0
2: 0
3: 8
4: 126
937997908_937997912 13 Left 937997908 2:127708892-127708914 CCTGAAACAAGAAACAAATCTCC 0: 1
1: 0
2: 0
3: 38
4: 379
Right 937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG 0: 1
1: 0
2: 0
3: 8
4: 126
937997907_937997912 14 Left 937997907 2:127708891-127708913 CCCTGAAACAAGAAACAAATCTC 0: 1
1: 0
2: 1
3: 41
4: 510
Right 937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937997912 Original CRISPR CAGTGTGACCAGAAGTAGAT GGG Intronic
902092175 1:13912339-13912361 GTGTGTGCCCACAAGTAGATTGG - Intergenic
902235610 1:15055504-15055526 AAGTGAGACCAGAAATAGAGGGG - Intronic
902359035 1:15932021-15932043 AAGAGTGACCAGAAAGAGATTGG + Exonic
902418124 1:16254814-16254836 CAGTATGGCCAGAAGTGGACAGG + Intronic
902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG + Intronic
904750786 1:32740670-32740692 CCGTGTGACCAGAGTCAGATTGG + Intergenic
905730518 1:40296150-40296172 CAGTTTGACCAGAAACAGCTAGG + Intergenic
906680291 1:47721621-47721643 CATTGTGAACAGAAGTGGAGAGG - Intergenic
908183237 1:61626772-61626794 CAGTGGGATCAAAAGTAAATTGG - Intergenic
915444475 1:155966960-155966982 CTGTGTGGCCAGGAGGAGATGGG - Intronic
915506957 1:156363737-156363759 CAGTGTGACAAGATGTGGAGGGG - Intronic
916518595 1:165543541-165543563 CAGTGTTGCCAGAAGAAGATGGG - Intergenic
920020943 1:202956259-202956281 CTGTGTGATAATAAGTAGATGGG + Intronic
922188561 1:223297271-223297293 TAGTGTGAACAGAAGAACATAGG + Intronic
924198554 1:241637043-241637065 CTGTGTGGCCAGAGGTAGAAAGG + Intronic
1064521010 10:16200836-16200858 GTGTGTGAACAGAAGTAGACTGG + Intergenic
1065371653 10:24992877-24992899 CAGTGTTTCCTGAAGTGGATTGG - Intronic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1069884484 10:71615257-71615279 CACAGAGACCAGAAGGAGATTGG + Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1072934294 10:99697452-99697474 CAGTCTGGCAAGAAGTAGTTTGG - Intronic
1075739928 10:124689072-124689094 CATTGTCAGCACAAGTAGATAGG - Intronic
1078589662 11:12628465-12628487 CATTGAGACCAGATGTAGCTGGG - Intergenic
1079953283 11:26830966-26830988 GAGTATGAGCAGAAGTAGACTGG + Intergenic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1084118590 11:67056163-67056185 CAGTGTGATCAGAACTACAACGG - Intergenic
1085679286 11:78556366-78556388 CAGTATAACTAGAAGTTGATGGG - Intronic
1087265013 11:96050940-96050962 CAGTCTGCCCAGAAGAATATAGG - Intronic
1088962641 11:114684826-114684848 CAGTGTGACAGGAAGTTGAATGG + Intronic
1089853701 11:121522299-121522321 CAGTGTCAACTCAAGTAGATGGG - Intronic
1093753594 12:22829012-22829034 CAGAGGGATCAGAAGAAGATAGG + Intergenic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1097902033 12:64882849-64882871 CACTGTCACCGGAAGTACATGGG - Intergenic
1102499499 12:113341705-113341727 CATTGTGAGCAGAAGTAGTGTGG + Intronic
1109556963 13:63989676-63989698 CAGTGTGGCAACAAGAAGATAGG + Intergenic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1114548575 14:23520520-23520542 CAGTGTCACCAAAAGTATCTTGG - Intergenic
1118648436 14:67864227-67864249 AAGTGTAACTAGAAGTAGTTTGG - Intronic
1120671318 14:87365697-87365719 CAGTGGGACCAGATGCAGTTTGG - Intergenic
1125285703 15:38090335-38090357 CAGTCTGACCAGAAGTTCAGTGG + Intergenic
1125436765 15:39654023-39654045 CAGTGGGACAAGATGTAGAGTGG - Intronic
1127192768 15:56549263-56549285 CACTGTGACCAGTAGTAGCAAGG + Intergenic
1127529273 15:59827305-59827327 CAGTGTGATCAAAAATAGACAGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137847755 16:51708878-51708900 AGGTGTCACTAGAAGTAGATGGG + Intergenic
1138209656 16:55152792-55152814 CACCATGATCAGAAGTAGATTGG + Intergenic
1141382613 16:83589404-83589426 CAGTGTCAGCGGGAGTAGATGGG - Intronic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG + Intronic
1144371699 17:14597627-14597649 GAGGGTGACCAGAAGTAGAGTGG + Intergenic
1146832593 17:36082563-36082585 GAGTGTGAGCAGAAGAGGATAGG + Intergenic
1147457232 17:40545471-40545493 AAGTGAGACCAGGAGAAGATGGG + Intergenic
1148743886 17:49907871-49907893 CACTGTGCCCAGAAGGAGAGAGG - Intergenic
1149391617 17:56197239-56197261 CAGTGTGTGCAGAATCAGATAGG - Intronic
1150944592 17:69731258-69731280 CAGTGGGCCCAGAATGAGATCGG + Intergenic
1156738895 18:40299951-40299973 CACTGTGATGAGAATTAGATCGG + Intergenic
1162990136 19:14296617-14296639 CATTGGGAGCAGTAGTAGATTGG - Intergenic
1167734233 19:51282109-51282131 CAACGTGACCAGAAGTAGCTTGG + Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
929663583 2:43815215-43815237 CAGTTTCACCTGAAATAGATTGG - Intronic
933042405 2:77486204-77486226 CATTGTCATCAGAAGTAAATAGG + Intronic
934096982 2:88615748-88615770 CAGAGGGGCAAGAAGTAGATTGG - Intronic
937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG + Intronic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948226266 2:236311466-236311488 AAATGTGACCAGAATGAGATAGG - Intergenic
1170718550 20:18854172-18854194 CAGAGTGACAACAAGAAGATTGG - Intergenic
1170918936 20:20657270-20657292 CAGTGTGACCAGAAATGGCGAGG + Intronic
1172184741 20:33024331-33024353 CAGTGTGACCAGAAGGGCAGAGG - Intergenic
1173354317 20:42272790-42272812 CAGTGTGACCAGATGAGGTTAGG - Intronic
1174610875 20:51797867-51797889 CAGTGTCTCCAGAATTTGATTGG - Intronic
1177255007 21:18650703-18650725 CAGAGGGACCAGAACTACATGGG - Intergenic
1179033119 21:37737242-37737264 CAGAGTGGCCAGAAGTAAACTGG + Intronic
1182112710 22:27734643-27734665 CTGTGTGTGCAGAAGTGGATGGG - Intergenic
951094420 3:18611479-18611501 CGGTTTGACCAGTAATAGATAGG - Intergenic
951343152 3:21513344-21513366 CAAAATGACCAGAAGTTGATAGG + Intronic
956499360 3:69865529-69865551 CAATGTGTTCAGAATTAGATTGG + Intronic
957324043 3:78669215-78669237 TAGCTTGAGCAGAAGTAGATGGG - Intronic
957934162 3:86920967-86920989 CTCTGTGACCAGAATGAGATTGG + Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
964677275 3:159297732-159297754 CAGGGTGACCCTAAGTTGATTGG - Intronic
966541000 3:181089723-181089745 CAGTGTTATCAGCAATAGATTGG + Intergenic
967042230 3:185704333-185704355 CAGAGTGACCAGAAGTTTTTAGG - Intronic
967145027 3:186599236-186599258 CAGGGTGACCTGGAGTGGATGGG - Intergenic
970573803 4:17407963-17407985 CATAGTGACCAAAAGAAGATAGG - Intergenic
970879456 4:20911414-20911436 AAGTGTGAGTAGAAATAGATTGG + Intronic
972028550 4:34420062-34420084 CAGTGCCAGCAGTAGTAGATTGG - Intergenic
973113493 4:46425357-46425379 CAGAGTGGCTAGAAGAAGATAGG - Intronic
975083209 4:70305368-70305390 CAATGTAACAAGAAGTAGATAGG + Intergenic
977991094 4:103443293-103443315 CACTGTGGGCAGAAGTAGTTTGG + Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
990728907 5:58786897-58786919 CAGCGCGTCCAGAAGTAGAAAGG + Intronic
991950889 5:71945946-71945968 CAGTGTGGCCACAAGGAGAGGGG + Intergenic
992223393 5:74594781-74594803 CACTGTGTCCAGGAGAAGATAGG - Intergenic
997081422 5:130743996-130744018 CAGTGTCATCAGAAGGATATAGG - Intergenic
999250437 5:150179405-150179427 GAGTGAGACCAGATGGAGATAGG - Intronic
1001587663 5:172844509-172844531 CAGTGTGACCAGGACAAGCTCGG + Intronic
1003411868 6:5872021-5872043 CAGTGTGCCCAGAAGAGGAATGG - Intergenic
1003630911 6:7786275-7786297 CAGTGTTCCCAGTAGTAGAGAGG - Intronic
1005788456 6:29271391-29271413 CAGTCTGAACTGAAGGAGATGGG - Intergenic
1008627364 6:53330899-53330921 CAGTGGGACAAGATGTAGAAGGG - Intronic
1009570795 6:65381413-65381435 CAGTGTGAACACATGGAGATAGG + Intronic
1011399848 6:86948650-86948672 CAGTGTGACCTGAACGATATGGG - Intronic
1015203106 6:130604139-130604161 CAGTGGGACCTGAATTAGACTGG - Intergenic
1015574651 6:134658609-134658631 TCATTTGACCAGAAGTAGATGGG + Intergenic
1015873967 6:137803932-137803954 CAGTTTTACCAGAAATAGTTTGG + Intergenic
1018098421 6:160414330-160414352 CAGTGTCACCAAGAGTTGATGGG - Intronic
1019098943 6:169611769-169611791 CAGTGGGACCAGATGTGGAGGGG - Intronic
1019193102 6:170265474-170265496 CAGTGAGACCAGATGTGGAGGGG - Intergenic
1021233120 7:18109437-18109459 CAGTGTTTCCTAAAGTAGATGGG + Intronic
1022872118 7:34490511-34490533 AAGTGTGATCAGAAGTATAGAGG - Intergenic
1026186654 7:68087050-68087072 CACCGTGAACAGAAGTAGCTTGG + Intergenic
1029225155 7:99021125-99021147 AAATGAGACCAGAAGTAGAGAGG + Intergenic
1033948773 7:146757912-146757934 CAATGTAATCAGAAGTAAATAGG - Intronic
1044365581 8:91341678-91341700 GAGTGTGACCAGAAGCAACTGGG - Intronic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1047478153 8:125255542-125255564 CAGTGTGATCACAAGCAGAGAGG + Intronic
1049168597 8:141143050-141143072 CTGTGTGATCAGAACTAGAAGGG + Intronic
1050123631 9:2333971-2333993 CAGTGTCACCATCTGTAGATGGG + Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051904573 9:22080438-22080460 TATTGTGAACAGAAGTAGCTAGG - Intergenic
1052292779 9:26863315-26863337 CAGTATTACCTGAAGTAAATGGG + Intronic
1056461640 9:86814729-86814751 CATTGCAACCAGAAGTAGTTGGG + Intergenic
1056623003 9:88230146-88230168 CAGACTCACCAGAAGTAGACAGG - Intergenic
1056812413 9:89775013-89775035 CAGGGTGACCAGAAGAGAATCGG - Intergenic
1057192339 9:93095117-93095139 CAGTGTGACCCGAACTAGAGAGG - Intergenic
1057229487 9:93311093-93311115 CAGAGAGACCAGAAGCAGAATGG - Intronic
1058807764 9:108608746-108608768 GAGTGTGACCAGCACTAGAATGG + Intergenic
1061888273 9:133604140-133604162 CAGTGTGAATAGAAATAAATAGG - Intergenic
1193892861 X:87072294-87072316 CAATATGACCAGAAGATGATTGG - Intergenic
1194168819 X:90556530-90556552 CAGTGGGCTCAGAAGAAGATAGG + Intergenic
1194583351 X:95703716-95703738 AAGTTTGACCAGAAGTAGCCTGG + Intergenic
1194714883 X:97276752-97276774 CAGTGTGACATTAAGTAGTTTGG + Intronic
1194768013 X:97865450-97865472 CAATGTGACCAGAAGCTTATAGG - Intergenic
1197498240 X:127212098-127212120 CAGTAAGAACAGAAATAGATAGG - Intergenic
1199882423 X:151985090-151985112 GTGTGTGACCAGAAGTAGCTAGG + Intergenic