ID: 938000852

View in Genome Browser
Species Human (GRCh38)
Location 2:127735349-127735371
Sequence CACCGAGCTTTGGGATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938000852_938000856 18 Left 938000852 2:127735349-127735371 CCATAGGATCCCAAAGCTCGGTG No data
Right 938000856 2:127735390-127735412 ACATAATAAGTTTTATTTGAAGG 0: 1
1: 0
2: 1
3: 41
4: 452
938000852_938000857 28 Left 938000852 2:127735349-127735371 CCATAGGATCCCAAAGCTCGGTG No data
Right 938000857 2:127735400-127735422 TTTTATTTGAAGGTCAGAAATGG 0: 1
1: 0
2: 5
3: 50
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938000852 Original CRISPR CACCGAGCTTTGGGATCCTA TGG (reversed) Intronic
No off target data available for this crispr