ID: 938000856

View in Genome Browser
Species Human (GRCh38)
Location 2:127735390-127735412
Sequence ACATAATAAGTTTTATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 452}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938000854_938000856 8 Left 938000854 2:127735359-127735381 CCAAAGCTCGGTGAACAGTCTGA No data
Right 938000856 2:127735390-127735412 ACATAATAAGTTTTATTTGAAGG 0: 1
1: 0
2: 1
3: 41
4: 452
938000852_938000856 18 Left 938000852 2:127735349-127735371 CCATAGGATCCCAAAGCTCGGTG No data
Right 938000856 2:127735390-127735412 ACATAATAAGTTTTATTTGAAGG 0: 1
1: 0
2: 1
3: 41
4: 452
938000853_938000856 9 Left 938000853 2:127735358-127735380 CCCAAAGCTCGGTGAACAGTCTG No data
Right 938000856 2:127735390-127735412 ACATAATAAGTTTTATTTGAAGG 0: 1
1: 0
2: 1
3: 41
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938000856 Original CRISPR ACATAATAAGTTTTATTTGA AGG Intronic
903386192 1:22928520-22928542 ACATTAAAAGATTTATTTCAAGG + Intergenic
904279439 1:29408636-29408658 ACATAATAAATTATATTTTATGG - Intergenic
907086087 1:51675787-51675809 ACAGATAAAATTTTATTTGAAGG - Intronic
907194802 1:52677869-52677891 ACATAATAAATCTTTATTGAAGG - Intergenic
908021897 1:59906522-59906544 ACATAGTAAATTTTATGTTATGG - Intronic
909233599 1:73122563-73122585 ATAAAATAATTTTTATTTTAAGG - Intergenic
909266161 1:73560154-73560176 ATATAATAAGACTTATTAGAGGG - Intergenic
909692252 1:78421732-78421754 ACCTAACAAGTTCTATGTGAAGG - Intronic
909723312 1:78802979-78803001 TCATGATAATTTTTATATGACGG + Intergenic
909962137 1:81859706-81859728 ACATTAAAAATTTTATTTCAGGG - Intronic
909967812 1:81938999-81939021 ACATAATAAATGTTATCTGATGG - Intronic
910006917 1:82408628-82408650 AAATAATGAGTTGTATTTAAAGG + Intergenic
911788170 1:101977742-101977764 ACATAAAAGGCTATATTTGATGG - Intronic
912309136 1:108602033-108602055 TCATGATAAGTTTTATGTGTAGG + Intronic
912747226 1:112254988-112255010 AATTAATAAATTTTAGTTGAAGG - Intergenic
916016949 1:160758369-160758391 GCATAATAAGTTTTAATTGCAGG - Intergenic
916182283 1:162095883-162095905 ACATGATAAGTAGTCTTTGAAGG - Intronic
916925198 1:169512123-169512145 ACATTATAAGTTTCATTTTATGG + Intergenic
916990483 1:170238482-170238504 ACCTAATGCATTTTATTTGAGGG - Intergenic
916994286 1:170279568-170279590 ACATAATATTTTATATTTTAAGG - Intergenic
917994687 1:180423542-180423564 ATATATGTAGTTTTATTTGAAGG - Intronic
918551751 1:185750328-185750350 ACATAATAAGTTTGATCTTTTGG - Intronic
919336406 1:196241758-196241780 AAGTAATTAGTTTTATTTGCAGG - Intronic
919421887 1:197379747-197379769 ATATAATAAGTTTCATAAGATGG + Intronic
919563650 1:199156835-199156857 ACATACTTGGTTTTATTTTATGG + Intergenic
919564509 1:199167448-199167470 AGATACTAAGTTTTACTTGTGGG + Intergenic
919636439 1:200007952-200007974 ACATACTTTGCTTTATTTGATGG - Intergenic
921635237 1:217484525-217484547 ATATAGAAAGATTTATTTGAAGG - Intronic
923089734 1:230730806-230730828 AGAAAATAACTTTTATCTGAGGG + Intergenic
923134077 1:231102205-231102227 AAAAAAGATGTTTTATTTGAGGG - Intergenic
924213084 1:241790787-241790809 ACATATTAATTTTTTATTGATGG + Intronic
924667247 1:246085765-246085787 ATAAAATAAATTTTATTAGAGGG + Intronic
1062865640 10:850718-850740 ATATATTAAGTCTTATTTTATGG - Intronic
1063400469 10:5739439-5739461 ATAACATAAGTTTTATCTGAGGG + Intronic
1063740336 10:8811082-8811104 ATATAATATTTTATATTTGAAGG + Intergenic
1064788876 10:18932600-18932622 ACATAATATGTCCTATTTAAAGG + Intergenic
1065146654 10:22776111-22776133 ACACAAACAATTTTATTTGAAGG + Intergenic
1065402019 10:25315642-25315664 TTATAATATGTTTTATTTGCTGG + Intronic
1068254759 10:54495032-54495054 AGATAATATTTTGTATTTGAGGG + Intronic
1068426838 10:56877415-56877437 ATAAAATAATTTTTATTTGGAGG - Intergenic
1069094727 10:64244790-64244812 AAATACTAAGTTTTATTAAATGG - Intergenic
1069165651 10:65154975-65154997 AAATAATAAATTTAAATTGATGG - Intergenic
1069945503 10:71982761-71982783 AGAAAGTAAGTGTTATTTGAAGG + Intronic
1069965782 10:72114721-72114743 ACATAATTAGTTTATCTTGAGGG + Intronic
1071130405 10:82386062-82386084 ATATAAAAATTTATATTTGATGG - Intronic
1072074598 10:91957138-91957160 ACTTAATAAATTTTATTTCTAGG - Intronic
1072889164 10:99306496-99306518 ACATAATGAGGTTTTTTTGGGGG - Intergenic
1073114624 10:101084666-101084688 ACATACCAAATTTTATTTCAAGG + Intergenic
1073702282 10:105941419-105941441 ACTTAATAACTGTTATTTAATGG - Intergenic
1073859670 10:107723267-107723289 ACATAAGATGTATTATTTTACGG + Intergenic
1074242320 10:111651567-111651589 ATATAATGAGTCTTATTTGGTGG + Intergenic
1074794566 10:116928884-116928906 AGATAATAAGTATTAATAGAAGG + Intronic
1075218502 10:120561541-120561563 ACATAATAAATTTTATAATAAGG + Intronic
1077769371 11:5198358-5198380 ACAGTATAAGGTTAATTTGAAGG - Intergenic
1078319660 11:10322838-10322860 TCATACTCAGTTTTCTTTGAGGG + Intronic
1078426976 11:11259920-11259942 ACAGGATCAGTTGTATTTGATGG - Intergenic
1078841451 11:15079340-15079362 TAATAATAAGTTTTAATTTAAGG + Intronic
1078941329 11:16009460-16009482 AAATGATAAGTTTTATTGGTAGG + Intronic
1080107113 11:28522283-28522305 ATATAGAAAGGTTTATTTGAAGG + Intergenic
1080133255 11:28821171-28821193 ACATTGTAATTTTTATTTTACGG + Intergenic
1080222836 11:29926102-29926124 ACATAATAAGTATTGTATGAAGG - Intergenic
1080229987 11:30009997-30010019 ATGTAATAAGTTTTGTTTGCAGG - Exonic
1081043683 11:38244463-38244485 AAATAATTAGTTTTATTTTAGGG - Intergenic
1081260330 11:40952129-40952151 ACATTATTATTTTTATTTTAAGG + Intronic
1082911649 11:58383225-58383247 AAATAATCAATTTTATTTTATGG + Intergenic
1083423434 11:62569507-62569529 AGACACTAAGTTTAATTTGAAGG - Intronic
1084139191 11:67212940-67212962 AAACAGTAAATTTTATTTGAAGG + Intronic
1085104294 11:73828947-73828969 ATAAAATTAGTTTTGTTTGAGGG + Intronic
1085191177 11:74624412-74624434 AAATAATGTGTATTATTTGAAGG - Intronic
1086267445 11:85018213-85018235 ACATAATCAGCTTTCTTTTAGGG + Intronic
1087311075 11:96544594-96544616 ACACAAGAAGTTTGATTTAATGG - Intergenic
1087360542 11:97153191-97153213 ACATAATATATTTTAATTCATGG + Intergenic
1087586958 11:100133878-100133900 ACATTATAAATTGAATTTGAGGG - Intronic
1087956785 11:104298330-104298352 GCATAATAAGGTTTCTGTGATGG - Intergenic
1088994323 11:114983282-114983304 GCATAATAAGATCTATTTTATGG + Intergenic
1092704985 12:11272558-11272580 ACATAATATATATTATGTGATGG + Intergenic
1093621747 12:21299122-21299144 ACTTAAAAATGTTTATTTGACGG - Intronic
1093670590 12:21870084-21870106 ATATAATAAATGTTATGTGAAGG - Intronic
1094070308 12:26405483-26405505 AAATAAAATGTTTTATATGAGGG + Intronic
1094554082 12:31481295-31481317 ACTTAATAAATGTTTTTTGACGG - Intronic
1095327540 12:40914483-40914505 ACATAATGTATTTTGTTTGACGG - Intronic
1095544510 12:43348952-43348974 ACATAATAAGTTTTCATAAATGG - Intergenic
1098405282 12:70119097-70119119 ACAGAATAAGCTTTAGGTGAGGG + Intergenic
1098936174 12:76482251-76482273 GCTTCATAAGTTTTATTAGAGGG - Intronic
1099320945 12:81147812-81147834 GGAAAATAAATTTTATTTGAAGG - Intronic
1099412342 12:82346867-82346889 ACAAAATGACTTTTCTTTGAGGG - Intronic
1099746438 12:86710005-86710027 TCATAATCACCTTTATTTGAAGG - Intronic
1099834959 12:87897587-87897609 AAATAATAAGTTTAATTAGTAGG - Intergenic
1100231834 12:92616854-92616876 ACTTAATAAGTGTTACTTGAAGG - Intergenic
1100568626 12:95824319-95824341 ACATGGTAAGTTTTATTTTTTGG - Intergenic
1100840037 12:98603665-98603687 TTATAATAGGTTTTATTTGTGGG + Intronic
1101357059 12:103989841-103989863 ACAAAATAATTTTTTTTTAAAGG - Intronic
1103080379 12:118019051-118019073 ACATACTAAATTGTATTTCAGGG + Exonic
1103102185 12:118187705-118187727 ACAAAATAAGTTGTTTTTGTGGG - Intronic
1104009334 12:124918185-124918207 ATATAATAAGCTTTGTTTAAGGG + Intergenic
1104072148 12:125355140-125355162 ACTTATTAAGCTTTATTTGATGG + Intronic
1104183741 12:126408286-126408308 ACAGTATAAGTTTTATGGGAGGG - Intergenic
1104229122 12:126866597-126866619 AAATATTATGTTTTATTTGAGGG + Intergenic
1105444904 13:20445109-20445131 ACATAAAAAAGTTTATGTGAAGG + Intronic
1106206889 13:27606219-27606241 ACCAAATATGTTTTATTTCATGG + Intronic
1106926291 13:34616428-34616450 TTATAATAAGTTTCCTTTGAAGG - Intergenic
1107282618 13:38754269-38754291 ACATAATACTTATCATTTGAGGG + Intronic
1108101896 13:46965777-46965799 GCCCAATAAGTTTTATTTTAAGG - Intergenic
1108451426 13:50569655-50569677 AAATAATAGGTTTTCTTTGTTGG - Intronic
1108641286 13:52384743-52384765 AGAGAATAAGGTGTATTTGAGGG + Intronic
1109858300 13:68162777-68162799 TCATAATTAGCGTTATTTGAAGG - Intergenic
1109985708 13:69981981-69982003 ACATAAAAAGTTTTAAATGTTGG + Intronic
1110490086 13:76093074-76093096 ACATGCTACGTTTTTTTTGAGGG + Intergenic
1110689967 13:78421437-78421459 GCATAATTAGTTTTATTTTGTGG - Intergenic
1110787830 13:79553996-79554018 GCATAATAAATTTTATTTTTTGG - Exonic
1110953529 13:81523635-81523657 ACAAAATATGTGTTAATTGATGG + Intergenic
1110986192 13:81972621-81972643 ACTTAATAAGATTTATTGAAGGG + Intergenic
1111072346 13:83185295-83185317 AAATAAAAACTTTTAATTGAAGG + Intergenic
1111346622 13:86964901-86964923 AAATAATATGTATTATATGATGG + Intergenic
1112166503 13:96925915-96925937 AAATACAAAGTTTGATTTGAAGG - Intergenic
1112801463 13:103114952-103114974 ATATAAAAAGCTTTATTTCATGG + Intergenic
1112936386 13:104804880-104804902 ACATAATTGTTTTTATATGAGGG + Intergenic
1112947901 13:104954933-104954955 ACATATTCAGGTTTATTTTAGGG + Intergenic
1112995106 13:105564860-105564882 ACAAAATATTTTTTATTTCATGG + Intergenic
1113096530 13:106670204-106670226 ACAGATTAAGTTCTATTTCAGGG - Intergenic
1113303411 13:109048717-109048739 AAATAATAATTTTTATTTGCAGG + Intronic
1113721304 13:112559694-112559716 ACATTATAAGAATTATTTCAGGG - Intronic
1114074711 14:19152335-19152357 AGAAAATTAGTTTTATTTAATGG + Intergenic
1114087556 14:19247640-19247662 AGAAAATTAGTTTTATTTAATGG - Intergenic
1114348613 14:21824913-21824935 ATATAATAAATTTTTATTGAGGG - Intergenic
1114571792 14:23674460-23674482 ACAGAAAAAGATTTATTTTAAGG - Intergenic
1115001835 14:28430714-28430736 ACATAATAAGGTTTATTAAAAGG - Intergenic
1115393674 14:32882447-32882469 ACTTTTTAAGTTTTATTTCAAGG + Intergenic
1115519870 14:34222496-34222518 ACATAATAACGTCTTTTTGAGGG + Intronic
1117200843 14:53388499-53388521 ACAAATTAAGTTTTAGTTGTTGG - Intergenic
1118759029 14:68866833-68866855 ACATAATATATATTAATTGATGG + Intergenic
1118885177 14:69860086-69860108 ACATAACAAATTTAATTTGCAGG - Intronic
1119501412 14:75130820-75130842 TCATAATAAAATTTATTTGAGGG + Intergenic
1120291027 14:82570683-82570705 AAATATTAAGTATAATTTGATGG - Intergenic
1120356381 14:83439697-83439719 AAATAATAAGATTTATATTAAGG + Intergenic
1121916894 14:97843695-97843717 AAATAATTTGTTTTATTTTATGG + Intergenic
1122223202 14:100255282-100255304 ACAAAATATGTTTTATTTTAAGG + Intronic
1123789633 15:23708071-23708093 GCAGAGTAAGCTTTATTTGATGG + Intergenic
1125737391 15:41936606-41936628 AAACAAAAAATTTTATTTGATGG - Intronic
1125907901 15:43410181-43410203 ACTTTATAAGTTATATATGAAGG + Intronic
1125936371 15:43639666-43639688 AAATAATAATTTGAATTTGACGG + Exonic
1126614866 15:50567449-50567471 ATAAAATAAGTTTTATTTTCGGG - Intronic
1126687104 15:51257798-51257820 ACATAATAACTTTTAATTTTTGG + Intronic
1127620099 15:60725805-60725827 ATTTAATTAGATTTATTTGAGGG - Intronic
1129754634 15:78090049-78090071 ACATAGTAAGTGTTCTTGGAGGG - Intronic
1131767283 15:95692139-95692161 GCTTAATAAATTTTATTTTAGGG - Intergenic
1131886916 15:96925883-96925905 CCATAATAACTTTTACTTTATGG - Intergenic
1133007097 16:2889654-2889676 AAATAAAAAGTTTTTTTTAAAGG - Intronic
1133678454 16:8097810-8097832 ACACATTGATTTTTATTTGAAGG - Intergenic
1137265017 16:46861688-46861710 TCATATCAGGTTTTATTTGAGGG - Intergenic
1137476500 16:48814049-48814071 ATATAATAGGTTTTTATTGAAGG + Intergenic
1138951073 16:61913976-61913998 ACATAATCATTTTTGTTTAAAGG - Intronic
1139931750 16:70532677-70532699 ACCTAATAGGTTTTACTTAAAGG + Intronic
1140776454 16:78253245-78253267 ACATGCTAAGTGTTATATGATGG - Intronic
1140813162 16:78597592-78597614 ACTTAATGAGGTTAATTTGAAGG - Intronic
1140981562 16:80114688-80114710 ACTTAATAAATATTAGTTGAAGG + Intergenic
1143735199 17:8906906-8906928 ACATCATAAGATTTATTAAATGG - Intronic
1145405874 17:22592278-22592300 ACCTAATGAGTTTTATGTGGAGG + Intergenic
1146840700 17:36151798-36151820 AAAGAATAAATCTTATTTGATGG + Intergenic
1149858825 17:60109172-60109194 AAAGAATAAATCTTATTTGATGG - Intergenic
1150306552 17:64090239-64090261 ATGTAATAAGTTTTCTTTGGAGG + Intronic
1155046327 18:22106480-22106502 ACAAGATGAATTTTATTTGAGGG - Intergenic
1155947411 18:31871160-31871182 TTAAAATATGTTTTATTTGAGGG - Intronic
1156069912 18:33194555-33194577 AAATACAAAGTTTTATTGGATGG - Intronic
1156115501 18:33782236-33782258 ACATAATCAATTTTTGTTGATGG - Intergenic
1156190379 18:34713298-34713320 ACATAATTAATTAAATTTGAGGG - Intronic
1156446350 18:37239895-37239917 AGCTAATAATTTTTATTTGGGGG + Intergenic
1157328196 18:46684390-46684412 ACATACTAAGTTTTATTATAAGG - Intronic
1157988778 18:52470582-52470604 ACAGAAAACATTTTATTTGAGGG + Intronic
1158985274 18:62809104-62809126 AAAATATATGTTTTATTTGAAGG + Intronic
1159314045 18:66748059-66748081 ACCTACTAAGCTTTATTTGCAGG - Intergenic
1162159570 19:8701767-8701789 ACATAGTAAGTGCTATGTGAGGG + Intergenic
1163069493 19:14827190-14827212 ATATAATAAGTATTAATAGAAGG + Intronic
1164035159 19:21447556-21447578 ACTAAATAAGTATTTTTTGATGG + Intronic
1164100015 19:22046396-22046418 ACATAATCTGTCCTATTTGAGGG + Intergenic
1164550716 19:29210097-29210119 ACAAAACAAGTTTTATTTTAAGG + Intronic
1165666542 19:37634849-37634871 GCATAGGAAGTTTTATTTAAAGG - Exonic
1168528780 19:57109236-57109258 ATAAAATAACTTTTATTTTATGG + Intergenic
925458019 2:4034605-4034627 ACATAATTAGTATTATGTTAAGG - Intergenic
925665434 2:6249982-6250004 AAATTATAGATTTTATTTGAAGG + Intergenic
926754808 2:16226320-16226342 ACAAAATAATTTTTATTGTATGG + Intergenic
927394537 2:22634786-22634808 TAATAATAATTCTTATTTGATGG - Intergenic
927735970 2:25522550-25522572 ACATGATTAACTTTATTTGAAGG + Intronic
928454483 2:31406671-31406693 AGATGACAGGTTTTATTTGAAGG - Intronic
928805401 2:35144540-35144562 ACAAAATAAGTCTTATTTTCAGG + Intergenic
929296140 2:40248968-40248990 GCAGAATAAGTTTTATTTCTAGG + Intronic
929776515 2:44934016-44934038 ACATCATTAGCTTTATTTGGTGG - Intergenic
930154888 2:48096355-48096377 AGATAATAAAATTAATTTGAAGG - Intergenic
930400791 2:50882745-50882767 ACATAATAATTTATGGTTGAAGG - Intronic
930940306 2:57004421-57004443 ACATATTAGGTTTTGTTTTATGG - Intergenic
931001604 2:57790807-57790829 TCATTATATTTTTTATTTGAAGG + Intergenic
931444288 2:62313928-62313950 ACTTAATAGGTTCTATTTGATGG + Intergenic
931733467 2:65173752-65173774 AAATAAAAACTTTAATTTGAGGG - Intergenic
932010037 2:67966956-67966978 GGATAATAATTTTAATTTGAGGG + Intergenic
932640239 2:73438507-73438529 ACATACTGAGTTTGATTTGTCGG + Intronic
933295737 2:80488949-80488971 ACATTATTAGTTTTCTTTGTTGG + Intronic
933345078 2:81074030-81074052 ACATCATAAATATTATATGATGG + Intergenic
933375254 2:81471606-81471628 ATTTAAAAAGTTTTAATTGATGG - Intergenic
933430861 2:82176866-82176888 AAACAAATAGTTTTATTTGAAGG + Intergenic
933432810 2:82206100-82206122 ACATTGTAAATTTTACTTGATGG + Intergenic
937286448 2:120756603-120756625 ACATAATAAATTTCATTAGTTGG + Intronic
938000856 2:127735390-127735412 ACATAATAAGTTTTATTTGAAGG + Intronic
938865257 2:135412081-135412103 AAATAATAATGTGTATTTGATGG + Intronic
939684543 2:145182710-145182732 ACATAGTGACTTTTATTTAAAGG + Intergenic
939708817 2:145489357-145489379 AAAAAATAAGGTTTATTTTAAGG - Intergenic
940049738 2:149449616-149449638 AACTATTAAGTTTTTTTTGAAGG + Intronic
940260431 2:151774393-151774415 ACATAATATAGTTTATTTTAGGG + Intergenic
940275557 2:151937001-151937023 ACTGAATAAGTTTTCTTTGTAGG + Intronic
940497314 2:154448603-154448625 ACAATATATGATTTATTTGAAGG - Intronic
941250865 2:163160653-163160675 ATAGAAAAAGTTTGATTTGAGGG + Intergenic
941862188 2:170294645-170294667 TTTTAATAAGTTTAATTTGATGG - Intronic
942081837 2:172407312-172407334 ATATAACTAGTTTTGTTTGATGG - Intergenic
942385072 2:175433740-175433762 TAATAATAATTTTTATTTGGAGG + Intergenic
942387088 2:175453822-175453844 AGATATTAAGTTTTTTTTAATGG + Intergenic
942751747 2:179296018-179296040 ACTTAATCAGTTTTCGTTGAAGG - Intergenic
943105263 2:183538544-183538566 TCATAGTGAGCTTTATTTGAAGG + Intergenic
943235658 2:185316041-185316063 ACATTATTAGTTGTTTTTGATGG - Intergenic
943251015 2:185521777-185521799 CCATAATGAGTTTGCTTTGATGG + Intergenic
943508501 2:188793939-188793961 ACATAATAAATTTAATTAAAAGG - Intergenic
943815863 2:192253696-192253718 ACAGAAGAAGATTTATTTGAAGG + Intergenic
943962065 2:194277583-194277605 ACATGAGAACTTGTATTTGATGG - Intergenic
945167192 2:206958606-206958628 CCAAAATAATTTTTATTGGAGGG + Intronic
945205773 2:207330640-207330662 AGATAAAAGGTTTTACTTGAGGG - Intergenic
945539191 2:211062720-211062742 ACATAATTAGGAATATTTGATGG + Intergenic
945698828 2:213144517-213144539 ACAAAGTAAGTTTCATCTGATGG + Intronic
946817809 2:223597203-223597225 ACATAATAAATTTTTTATCAAGG + Exonic
947279280 2:228431022-228431044 ACAAAATTAATTTTATTGGAGGG + Intergenic
947676413 2:231984915-231984937 AAATAAAAAGTTTAATTTGCCGG - Intronic
947938976 2:234032188-234032210 ACTGAATAATTTTCATTTGAAGG - Intergenic
948072951 2:235142094-235142116 ACATAAAAAGAGTTATTTCAAGG - Intergenic
948559350 2:238841000-238841022 ACAAAACAAGATTTATTTGGAGG + Intergenic
1169759690 20:9077923-9077945 ATTTAATGAGTTTTATTTAATGG + Intronic
1170061192 20:12260991-12261013 ACACAATTAGTTGGATTTGAGGG + Intergenic
1170303737 20:14915320-14915342 ACACATTAAGCTTTATTTGGTGG - Intronic
1173624079 20:44458473-44458495 ACAGAATAAGTGCTATTTAAAGG + Intronic
1177577221 21:22973849-22973871 ACATGTGAAGTTTTATTTGCAGG - Intergenic
1177690140 21:24495191-24495213 ACAGAATAATTTAAATTTGAAGG + Intergenic
1177709252 21:24750181-24750203 AAATAATAAAATATATTTGAAGG + Intergenic
1179113459 21:38467792-38467814 ACATAATCAGTTTTCTTTTTTGG - Intronic
1180290360 22:10845269-10845291 AGAAAATTAGTTTTATTTAATGG + Intergenic
1180493158 22:15874690-15874712 AGAAAATTAGTTTTATTTAATGG + Intergenic
1180939850 22:19652855-19652877 ACAAAATATGTGTTAATTGATGG - Intergenic
1183884593 22:40867956-40867978 ACATAAGGAGTTTTGTTTGTTGG - Intronic
949148058 3:727808-727830 ACATACTGAATTTTTTTTGAGGG - Intergenic
949185333 3:1184558-1184580 TCATAATAGGCTGTATTTGAAGG + Intronic
950118872 3:10468543-10468565 AAATAATTACTGTTATTTGAGGG + Intronic
951467555 3:23018775-23018797 AAATAATAAATGTTATTTTAAGG + Intergenic
951542682 3:23797369-23797391 ACTTCATAAGGTTTTTTTGAAGG - Intergenic
951831199 3:26929309-26929331 ACATAATAGCTTTAGTTTGATGG - Intergenic
952046128 3:29322951-29322973 ATCTAATAAGTGTTATTTAAGGG + Intronic
952158150 3:30666371-30666393 AAATAAAAAGTTTTATGTGAAGG - Intronic
952756786 3:36876089-36876111 AAAAAATAAGTCTTATTTGTTGG - Intronic
953049315 3:39326285-39326307 TCATCATAATTTTGATTTGAAGG - Intergenic
955866960 3:63394958-63394980 GCATAATAAGTCTATTTTGATGG - Intronic
956103028 3:65788298-65788320 AAATAATAATTTTTATTTAAAGG + Intronic
956480934 3:69673444-69673466 ATTTATCAAGTTTTATTTGATGG + Intergenic
956524104 3:70138805-70138827 ACATTATATGTTTGATTTCACGG - Intergenic
956649279 3:71488894-71488916 ACATAATATGTTTTATAAGCTGG - Intronic
957375281 3:79348406-79348428 ACATATGAAGTTTTATCTTACGG + Intronic
957438007 3:80204577-80204599 ACATAATAAATTATATGGGAAGG + Intergenic
957695436 3:83632367-83632389 AAATAATAAAATTTATTTGATGG + Intergenic
958975657 3:100665765-100665787 ACATGATAATTTTTGTATGAAGG - Intronic
959430416 3:106247853-106247875 ACCTAATATATTTTATTTTAAGG - Intergenic
960124861 3:113987535-113987557 ACATGTAAAGTGTTATTTGAAGG + Intronic
960221677 3:115118941-115118963 ATATACTAAATTTTATTTGAGGG - Intronic
960527243 3:118723877-118723899 ACATGTTAAGTTTTATCTCAAGG - Intergenic
961979668 3:131063646-131063668 GCTTAATAAGTTTTGTCTGATGG + Intronic
962055560 3:131867647-131867669 ATACTATAATTTTTATTTGAGGG + Intronic
963578051 3:147088037-147088059 CCATTATAAGTTTTCTTTGTGGG - Intergenic
964164703 3:153688852-153688874 ACATTCTATTTTTTATTTGAAGG - Intergenic
964416731 3:156455639-156455661 TCATAATAATTTTTCTTTTATGG - Intronic
965046807 3:163588669-163588691 AAATAAAACGTTTTATTTAATGG - Intergenic
965728071 3:171740967-171740989 CCATAATTACTTTTATTTTATGG + Intronic
965990746 3:174814704-174814726 AAATAATAATTTTTGTTTCATGG - Intronic
966979007 3:185113092-185113114 AGATAAAAACTTCTATTTGAAGG - Intronic
967484037 3:190009241-190009263 ACATATTAGGTTTTATTTTGGGG + Intronic
970187086 4:13468337-13468359 ACATATTAAGGTATATTTTATGG - Intronic
970349875 4:15191699-15191721 ACATATTTACTATTATTTGAGGG + Intergenic
970395179 4:15658047-15658069 ACAGAATAAGTTATATTTTTAGG - Intronic
970810569 4:20088626-20088648 ACAACACAGGTTTTATTTGAAGG - Intergenic
971071573 4:23098902-23098924 ACATAAAGAGATTTATTTTAAGG - Intergenic
971226295 4:24754730-24754752 ACATAACAAGCTTTATTGGGTGG + Intergenic
971997680 4:33987227-33987249 ACCTAATGAGTTTTATGTGGAGG - Intergenic
972241172 4:37194194-37194216 AAATAATAAGATTTATATGTTGG - Intergenic
972392840 4:38629325-38629347 ACAAAATATGTATTAATTGATGG - Intergenic
972687653 4:41366707-41366729 ACATAAGATGTTATATTTCAAGG + Intronic
972758829 4:42081039-42081061 ACAAAATGAGTCTTATTTCAAGG - Intronic
973822314 4:54673028-54673050 ACATACCAAGTTAAATTTGAGGG - Intronic
973868475 4:55139358-55139380 ATATAAAAAGTATTATGTGATGG - Intergenic
974295360 4:59992247-59992269 ATATATTAAGATTAATTTGAGGG - Intergenic
974343756 4:60650614-60650636 ACTTAACAAGATATATTTGAAGG - Intergenic
974642457 4:64648917-64648939 ACATGATAAACTTTATTTCATGG + Intergenic
974986876 4:69038468-69038490 ACATAATAAGCTATAATTGCTGG + Intronic
975432948 4:74316237-74316259 AAATAATAATTTATTTTTGAAGG + Intergenic
975617508 4:76261839-76261861 AAATAAAAAGTTTTTTTTTAAGG + Intronic
975993662 4:80288353-80288375 ACATATAATGTTTTAGTTGATGG - Exonic
976043587 4:80917531-80917553 ACATAAAATGTTGTGTTTGAGGG + Intronic
977171794 4:93771482-93771504 ACAAAATAATTTCTAATTGAGGG - Intronic
977501664 4:97847708-97847730 AGATAATAAGTTTTATTTTAAGG - Intronic
977813167 4:101382331-101382353 AAATAATAAGTTTGATTTAATGG - Intergenic
978012548 4:103705336-103705358 ACATAAAAAGTGGTATTTCATGG + Intronic
978033191 4:103961430-103961452 AAATAATAAGCTTTTTTTGAGGG + Intergenic
978784592 4:112595359-112595381 ACATAATAATTTTTTGTTCAGGG - Intronic
978836231 4:113152413-113152435 GCATAATAAGTTTTGATTAAAGG - Intronic
978933534 4:114347488-114347510 AAATAATAAGTAATAGTTGATGG + Intergenic
979814372 4:125081793-125081815 ATATAATTAATTTTATTTAAAGG - Intergenic
980138354 4:128883658-128883680 AGATAATGAGTTTGAGTTGAAGG - Intronic
980167343 4:129245048-129245070 ACATAATGAGATTCATCTGAGGG + Intergenic
980836356 4:138197858-138197880 ATATACTAAGTTGTATTTCAAGG - Intronic
981381379 4:144075877-144075899 ACATAACTGGTTTTATATGAAGG - Intergenic
981413844 4:144464493-144464515 ACTTAAAAAGTGTTATTTGAAGG + Intergenic
981591044 4:146361341-146361363 AGAATATAATTTTTATTTGATGG - Intronic
982062741 4:151621153-151621175 GCACACTAAGTTTTTTTTGAGGG + Intronic
982580367 4:157170217-157170239 ACATAATAAGGCTTATGTCATGG - Intronic
982665719 4:158259920-158259942 ACATAGCAAGTTGTATTTCATGG - Intergenic
982747102 4:159115369-159115391 AAATAATAAGTTGCATTTGAGGG + Intronic
983302366 4:165943520-165943542 AGATAAGCAGTTTTATTTCAAGG - Intronic
983349082 4:166564055-166564077 CTATAATAAGTTTTATTTGGAGG + Intergenic
984452487 4:179920567-179920589 AAATAATTAGATTTGTTTGATGG - Intergenic
984921899 4:184772134-184772156 GCATTTTAAGTTTTGTTTGAAGG + Intronic
986436248 5:7734551-7734573 ACATAATAAGTTATGCTTCAGGG + Intronic
987491670 5:18588332-18588354 TCATGATAAATTTTTTTTGATGG + Intergenic
990232699 5:53731338-53731360 ACATATTAATTTTTATATGTAGG - Intergenic
990390095 5:55310107-55310129 ATAAAATGAGTTTTATTTGCAGG + Intronic
990429694 5:55722623-55722645 ACACAATAAGATTAATTTGGGGG + Intronic
990555734 5:56933884-56933906 ACAAGATAACTTTTATTTAAAGG + Intronic
990655620 5:57951393-57951415 ATATAGTAAGTTTTCCTTGAAGG - Intergenic
990797229 5:59557373-59557395 ACATAGTGAGTTTTATTTTCTGG + Intronic
990876746 5:60494638-60494660 ACACAAAAAGATTTAGTTGATGG - Intronic
991084383 5:62635091-62635113 ACACATGAAGTGTTATTTGAAGG - Intergenic
991719026 5:69478820-69478842 ACAAAATAAATATTATTCGATGG - Intergenic
992400447 5:76406182-76406204 ACATAATAAATTGTACTTGAGGG + Intronic
992622558 5:78608250-78608272 AAAAAATAATTCTTATTTGAAGG - Intronic
992698399 5:79314159-79314181 ACATAACATCTTTTATTTGAAGG + Intronic
994062831 5:95500033-95500055 ACTTAAGTAGTTTTATTTTATGG + Intronic
994201752 5:96984515-96984537 ATTAAATAAGTTTTATTGGAGGG - Intronic
994898266 5:105734637-105734659 ACTTAATAAATGTTAGTTGAGGG + Intergenic
994909735 5:105887422-105887444 AAATAATCAGTTTTATTTGTTGG + Intergenic
995073713 5:107956123-107956145 CCATAATAATTTTCACTTGAAGG - Intronic
995216355 5:109599719-109599741 AGAGAATAAGCTTTATTGGAAGG + Intergenic
995675315 5:114656591-114656613 ACATGATAAAATTTATTTAATGG + Intergenic
996377806 5:122832669-122832691 ACATAATCAGCTTTCTTTAAAGG + Intergenic
997038268 5:130219561-130219583 ACATAATAATTTCTATTTTCTGG + Intergenic
997504587 5:134406983-134407005 AAAACATAAGTTTTATTTGAAGG + Intronic
997928939 5:138056463-138056485 AGCTAATAACTTTTACTTGAGGG - Intergenic
998302164 5:141033346-141033368 AAATAATGAGTTTTATTGCATGG + Intergenic
998722629 5:144972084-144972106 ACCTTATAATTTTTATTTGGAGG - Intergenic
998747838 5:145281590-145281612 ACATAATCCATTTTCTTTGACGG - Intergenic
999067091 5:148699346-148699368 ACATTATATGTGTTATTTCAAGG - Intergenic
999690422 5:154141433-154141455 AAATAATAAGATTTGTTTGATGG + Intronic
999876903 5:155817624-155817646 AAATAATAAGAATTATTTAAAGG + Intergenic
1000156564 5:158558185-158558207 ACAAAATAATTTTTGTGTGAGGG + Intergenic
1000853799 5:166373620-166373642 ACATAAAAATTTTTATTTTAGGG + Intergenic
1000887545 5:166764348-166764370 AAGTAATCAGTTTTATGTGAAGG + Intergenic
1002345901 5:178547424-178547446 GCATAAAGAGATTTATTTGAAGG - Intronic
1002682615 5:180979483-180979505 GCCTAATAAGTTATATTTTAGGG - Intergenic
1003511329 6:6783310-6783332 GCATTTTAAGTTTTATTTGCAGG + Intergenic
1004268628 6:14173419-14173441 AAATGATAAGTTTTATGTTATGG + Intergenic
1004619738 6:17322212-17322234 AGATATTTAGTTTTTTTTGATGG + Intergenic
1004855096 6:19741514-19741536 ACATTATAAGGTTTATATAAAGG + Intergenic
1006888932 6:37406848-37406870 AAATAAGAATTCTTATTTGATGG - Intergenic
1007921371 6:45612555-45612577 ACAGAATAAGTATTATTTTTTGG + Intronic
1007933560 6:45713758-45713780 GCAAAATAAGTTGTATTTGCCGG - Intergenic
1008143639 6:47862329-47862351 ACATACTAAATTTTTTTTGTAGG + Intergenic
1008538682 6:52527860-52527882 ACTTAATAAGTTTTAGTTATTGG + Intronic
1008918352 6:56815095-56815117 ACATTATAATTTTTATTTTATGG - Intronic
1009461050 6:63913837-63913859 AGATAATGTGTTTTTTTTGAAGG + Intronic
1009883063 6:69593180-69593202 AAATTATGAGTTTTATTTCAGGG + Intergenic
1010242162 6:73626458-73626480 ACATTACAAGTTATATTTCAGGG + Intronic
1010476267 6:76292518-76292540 ACATTATAACTTTTATTTTCTGG + Intergenic
1010873129 6:81065998-81066020 ATATTATCACTTTTATTTGATGG - Intergenic
1011083880 6:83517454-83517476 TCATAGTCAGTTTTATTTGGGGG - Intronic
1011781355 6:90793223-90793245 ACATACTATGTATTAATTGAAGG + Intergenic
1012109372 6:95208530-95208552 ACACTATAATTTTTCTTTGAGGG + Intergenic
1012635282 6:101530832-101530854 ACACCATAAGTTTTTTTGGAGGG + Intronic
1012640919 6:101612333-101612355 AAAATATAAATTTTATTTGATGG + Intronic
1012745615 6:103083279-103083301 ACCTAATAACCTTTGTTTGAAGG - Intergenic
1012959055 6:105603209-105603231 ACATGAGAAGCTTTCTTTGATGG + Intergenic
1013737586 6:113245751-113245773 TCATAAACAGCTTTATTTGAAGG - Intergenic
1013742973 6:113310372-113310394 ACATAATATGGTTTAATTTATGG - Intergenic
1015022422 6:128492573-128492595 ACACAATAATATTTATTTTACGG + Intronic
1015171030 6:130253729-130253751 AAATAATAATTTTAATTTGGTGG - Intronic
1015409741 6:132879845-132879867 ACATAACAATTTTTCTTTGGAGG - Intergenic
1015965860 6:138694244-138694266 GTCTAATAAGTTTTATTTGGAGG - Intergenic
1016193086 6:141294935-141294957 AAAAAATAAGGTTTATTTAATGG - Intergenic
1016284574 6:142458922-142458944 ACATAGAAAGATTTATTTTAGGG + Intergenic
1016834631 6:148465200-148465222 ACATAATAAGTTTTATCCTGAGG + Intronic
1017532756 6:155313337-155313359 ACATAAAATGTTTTATTTCTTGG - Intronic
1019880965 7:3860608-3860630 AGAAAATAACTTTTATTTGAGGG + Intronic
1020545391 7:9522681-9522703 AAATAATAAGTTTTTATTTATGG - Intergenic
1020992736 7:15220833-15220855 ACATAATTAGATTAATTTCAGGG - Intronic
1021079177 7:16343092-16343114 AAATAATAAGTTACATTTTACGG + Intronic
1022256583 7:28664316-28664338 AAATACCAAGTTTTACTTGAAGG - Intronic
1022832502 7:34082308-34082330 AACTAATAAGTTGTAATTGAGGG - Intronic
1025711661 7:63916707-63916729 ACATTATAAAATTTATTTGGAGG - Intergenic
1026402134 7:70025224-70025246 ACAGAATTAATTTTATTTTATGG + Intronic
1026811280 7:73467970-73467992 AAATCTGAAGTTTTATTTGAAGG + Intronic
1027646155 7:80801336-80801358 CCACAAAAAGTTCTATTTGATGG - Intronic
1027881738 7:83847283-83847305 GCATGATAAATTTTATTTTAAGG + Intergenic
1028063975 7:86358389-86358411 ACATCATAAATTTTAAATGAAGG + Intergenic
1028089190 7:86676499-86676521 ACATAATAAATTGTGTTTTAAGG + Intronic
1028795594 7:94898380-94898402 ATATAAGAAGGTTTATTTTAGGG + Intergenic
1029031589 7:97473646-97473668 ACATACTAACTTTTCTTAGAAGG + Intergenic
1030585696 7:111415924-111415946 TCATGATATGTTTTATTTGCAGG - Intronic
1030766599 7:113418212-113418234 ACATAATAAGTTATCTTTGGGGG - Intergenic
1030910967 7:115248427-115248449 ACAAAATAATATTTATTTTATGG + Intergenic
1031311456 7:120203248-120203270 ACATAAAATGTTTTCTTTGATGG - Intergenic
1031328979 7:120439474-120439496 AAATAATAAGTTTGAGGTGATGG - Intronic
1031555661 7:123172655-123172677 AAATATTAAGTCTCATTTGAGGG - Intronic
1031731351 7:125305139-125305161 ACATAGTAAGTTCCATTTAAGGG + Intergenic
1032830243 7:135617395-135617417 ATATATTAAGTTTTATTTCAGGG - Intronic
1033003349 7:137532378-137532400 TCATAAAATGTTTTATGTGAAGG - Intronic
1033778239 7:144638032-144638054 ACATAATAATTGTTATTTCATGG + Intronic
1033898058 7:146099753-146099775 ACAAATTAATTCTTATTTGAAGG + Intergenic
1034323355 7:150205897-150205919 ACAAAAACAGTTTTATTTGGTGG + Intergenic
1034769841 7:153763292-153763314 ACAAAAACAGTTTTATTTGGTGG - Intergenic
1035126240 7:156609598-156609620 TTAAAATAAGTTTTATTTCATGG + Intergenic
1037097423 8:15002394-15002416 ATATAGTACGTTTTATTTTAAGG + Intronic
1037120561 8:15281006-15281028 ACAAAATAAATTTTCTTTAAAGG + Intergenic
1037179201 8:15984462-15984484 ACATAATAAATAATTTTTGAGGG + Intergenic
1037528510 8:19751010-19751032 ACAAAATAATTTTTATCAGAGGG - Intronic
1037577313 8:20219715-20219737 AAAGAATAAGATTTATTTGTGGG + Intronic
1038091569 8:24259766-24259788 ATATAATAACTTTTATTTGGTGG - Intergenic
1038371104 8:26991440-26991462 GCATAATAAGATTTTTTTGATGG + Intergenic
1038519062 8:28213900-28213922 ATATAATGAGATTTATTTTAAGG + Intergenic
1038663270 8:29515479-29515501 ACATATTAAGCTTTATTTTAAGG - Intergenic
1038956519 8:32474281-32474303 CCATAGTCAGTTTTATTTCAAGG - Intronic
1040679182 8:49788337-49788359 ACATAATATGCTGTATTTTATGG - Intergenic
1040724567 8:50367453-50367475 AAATAATAAATTTTATATGCAGG - Intronic
1043364567 8:79517617-79517639 ACAAAATATGTGTTAATTGACGG - Intergenic
1043627618 8:82282607-82282629 ACATAAAAATTGTTATTTTATGG + Intergenic
1043724123 8:83588028-83588050 AAATAATAAGGTTTGTTTTATGG - Intergenic
1044075438 8:87816290-87816312 TCATAAATAGTTTTAGTTGAGGG - Intergenic
1044343655 8:91077259-91077281 CCAAAATAAGTTTTATTTTGGGG - Intronic
1044748801 8:95396794-95396816 AAATAAAAATATTTATTTGATGG + Intergenic
1044989820 8:97785889-97785911 AGAAAATAACTTTTATCTGAGGG - Intronic
1046251032 8:111631918-111631940 AAATAGTAAAGTTTATTTGATGG - Intergenic
1046289872 8:112144433-112144455 ACATAACAAATTATATTGGAAGG + Intergenic
1046639784 8:116716330-116716352 ACATATTAAGTTGTAATTCATGG - Intronic
1048414062 8:134206898-134206920 ACCTAATATGTTGTATTTGGGGG + Intergenic
1048758339 8:137764089-137764111 ACATAAAAATTTTAATTTCAGGG + Intergenic
1050611335 9:7357100-7357122 AAAAAATAAGTTTTATTTTCAGG + Intergenic
1050719135 9:8565028-8565050 TCATAATTACTTTCATTTGAGGG - Intronic
1050859388 9:10407057-10407079 GCATTATAATATTTATTTGATGG - Intronic
1051840449 9:21391797-21391819 ACAAAATATGTGTTAATTGATGG - Intergenic
1052532040 9:29698425-29698447 ATAAGATAATTTTTATTTGATGG + Intergenic
1053434599 9:38067000-38067022 ACAGAACAAGTATTATTTTATGG + Intronic
1053822916 9:41987636-41987658 ACATAATGAATTGTCTTTGATGG + Intronic
1054193106 9:62003223-62003245 ACATAATAAATGTTATGTGTGGG + Intergenic
1054607659 9:67199729-67199751 ACATAATGAATTGTCTTTGATGG - Intergenic
1054645301 9:67585468-67585490 ACATAATAAATGTTATGTGTGGG - Intergenic
1055172070 9:73270930-73270952 ACATTATAATTTTCATTTCATGG + Intergenic
1055190445 9:73514810-73514832 ACATAAATAGTGTTATTTCAGGG + Intergenic
1055256780 9:74381201-74381223 ACTTAACATGTTCTATTTGATGG + Intergenic
1056105767 9:83344768-83344790 ACATAATGAGATTTATTATAAGG - Intronic
1057535053 9:95893610-95893632 ACATATTCAGGTTTATTTCATGG + Intronic
1058415761 9:104786988-104787010 ATAAAATAAGTCTTATTTGCTGG + Intronic
1058511208 9:105719422-105719444 ACCTAATAAGTGTTGGTTGAGGG + Intronic
1059071920 9:111146913-111146935 ACCTAATAATCTCTATTTGAAGG - Intergenic
1059620702 9:116002458-116002480 ACATAAAAAATTTGCTTTGAGGG + Intergenic
1060869046 9:127024555-127024577 TAATAATAAGTGTTGTTTGATGG - Intronic
1185936572 X:4263143-4263165 ATATGATAAGTTTTTGTTGATGG - Intergenic
1186760821 X:12720153-12720175 AGATATTAAGTTTCATTTCAAGG - Intronic
1187515174 X:19962921-19962943 ACAAAATAATTTTTATTAGCTGG + Intronic
1187571711 X:20510417-20510439 ACATAATAAGGTTTTCTGGAGGG - Intergenic
1188281889 X:28280571-28280593 CCAAAATAAATTTTATTTGTTGG - Intergenic
1189154079 X:38737874-38737896 AATTAATAAGTTTTACTTAATGG + Intergenic
1189192950 X:39126785-39126807 ACAAAATAAGTTTTAAACGAAGG + Intergenic
1189625026 X:42887996-42888018 AAATAAGAAGTTTTAATTGTGGG + Intergenic
1189877788 X:45454854-45454876 ACAGTAAAAGTTTTCTTTGATGG + Intergenic
1190082985 X:47371341-47371363 AAAAAAAAAGTTTTATTTGCCGG + Intronic
1190489975 X:50972082-50972104 ACATAAATAGATTTATTTTAAGG - Intergenic
1192052220 X:67734792-67734814 ACATAATGAGTTTCAGTAGATGG + Intergenic
1193253571 X:79320772-79320794 AAATAATATGTATTATTTCAAGG + Intergenic
1193278456 X:79620049-79620071 AAATAATATGTATTATTTAAAGG + Intergenic
1193712954 X:84900971-84900993 AAATACTAAGTTTAATTAGAAGG + Intergenic
1193745149 X:85269119-85269141 ACATATTAAGATTGATTTTACGG - Intronic
1193848205 X:86501376-86501398 TCATAATATGTTATATCTGAAGG + Intronic
1194144215 X:90243755-90243777 ACATATCAAGTTTTGTTTCAAGG - Intergenic
1194652841 X:96535961-96535983 ACAATCTAAATTTTATTTGATGG - Intergenic
1194683326 X:96881161-96881183 ATATATTAAATTTTATTTGCTGG + Intronic
1194794007 X:98187671-98187693 ACTTAATTTGTTTTATTTGGTGG - Intergenic
1195821904 X:108955108-108955130 ACACACTAGGTTTTATTGGAGGG + Intergenic
1196079613 X:111617547-111617569 ATATAATTAGTTTTTTATGATGG + Intergenic
1196536192 X:116847394-116847416 ACATAATGAGATTTATTTTTAGG - Intergenic
1196712403 X:118776602-118776624 AAATAATAAATTTTATGTTATGG - Intronic
1196947538 X:120842649-120842671 ACAAAATAAATATTTTTTGATGG + Intergenic
1197019680 X:121671700-121671722 ACATAATAGATTTTTTTTAATGG + Intergenic
1197631096 X:128859282-128859304 ATATAATAGCTTTTACTTGATGG + Intergenic
1198128802 X:133673829-133673851 ACATAGAAAGTTCTATATGAGGG + Intronic
1198508204 X:137322615-137322637 ACATACTTATTTTTATTTTATGG - Intergenic
1198717299 X:139571879-139571901 ACATTATGAGTCCTATTTGATGG + Intergenic
1198997487 X:142590566-142590588 ACTTCAAAAGTATTATTTGAGGG - Intergenic
1200489979 Y:3813063-3813085 ACATATCAAGTTTTGTTTCAAGG - Intergenic
1202594115 Y:26519211-26519233 ACAAAAAAAGTAATATTTGAGGG - Intergenic