ID: 938000857

View in Genome Browser
Species Human (GRCh38)
Location 2:127735400-127735422
Sequence TTTTATTTGAAGGTCAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 503}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938000852_938000857 28 Left 938000852 2:127735349-127735371 CCATAGGATCCCAAAGCTCGGTG No data
Right 938000857 2:127735400-127735422 TTTTATTTGAAGGTCAGAAATGG 0: 1
1: 0
2: 5
3: 50
4: 503
938000855_938000857 -8 Left 938000855 2:127735385-127735407 CCAATACATAATAAGTTTTATTT 0: 1
1: 0
2: 4
3: 56
4: 693
Right 938000857 2:127735400-127735422 TTTTATTTGAAGGTCAGAAATGG 0: 1
1: 0
2: 5
3: 50
4: 503
938000854_938000857 18 Left 938000854 2:127735359-127735381 CCAAAGCTCGGTGAACAGTCTGA No data
Right 938000857 2:127735400-127735422 TTTTATTTGAAGGTCAGAAATGG 0: 1
1: 0
2: 5
3: 50
4: 503
938000853_938000857 19 Left 938000853 2:127735358-127735380 CCCAAAGCTCGGTGAACAGTCTG No data
Right 938000857 2:127735400-127735422 TTTTATTTGAAGGTCAGAAATGG 0: 1
1: 0
2: 5
3: 50
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938000857 Original CRISPR TTTTATTTGAAGGTCAGAAA TGG Intronic
900163342 1:1234968-1234990 ATTTTTTTGTAGGTCAGAAGTGG - Exonic
900811743 1:4807710-4807732 TGTTATTGGAAGCCCAGAAAGGG + Intergenic
901500212 1:9648107-9648129 TTTTATTTAACAGGCAGAAAAGG + Intergenic
903706402 1:25288956-25288978 CTTTAGGGGAAGGTCAGAAAAGG - Intronic
905140061 1:35836248-35836270 ATTTATATGAAGCTCAAAAATGG - Intronic
905933252 1:41804570-41804592 TTTTATGTGAAAGAGAGAAAAGG + Intronic
906950430 1:50330885-50330907 TGAGATTTGAAGGCCAGAAAGGG + Intergenic
907783212 1:57586263-57586285 TTTTATTTCAAGGGAAGAAGAGG - Intronic
907947483 1:59148494-59148516 TCTAATCTGCAGGTCAGAAAGGG - Intergenic
908136863 1:61142083-61142105 TTTTTTTTTAAGGAAAGAAAAGG - Intronic
908157371 1:61367702-61367724 TTTTTTCTTAATGTCAGAAAAGG + Intronic
910567786 1:88664797-88664819 ATTTTTTTGTAGGTCAAAAATGG - Intergenic
912116705 1:106416275-106416297 TATAATTTAAAGGTAAGAAATGG + Intergenic
912153599 1:106888335-106888357 TACTATTTGTAGGTCTGAAAGGG + Intergenic
912257091 1:108071197-108071219 TTGTATTTCAAGGTCTGGAAGGG + Intergenic
912593798 1:110853766-110853788 TTTCATTTCAAGGTCTAAAATGG - Intergenic
913375987 1:118153169-118153191 TTTTATTTTCTGGTCTGAAATGG - Intronic
914772427 1:150700682-150700704 TTTCATTTGAAAGTCAGAACTGG - Intronic
914931350 1:151936781-151936803 TTCTATATGAAGGTCAAACATGG + Intergenic
915802843 1:158812769-158812791 TGTGATTGGAAGGTTAGAAAAGG + Intergenic
915915371 1:159937475-159937497 TTATATTTGAAGAACTGAAAAGG + Intronic
916151151 1:161792357-161792379 ATTTATTTGGAGGGCAGTAAGGG + Intronic
916376714 1:164162856-164162878 TTTGATTTGCAGGTCAGGGATGG - Intergenic
916705344 1:167343679-167343701 TTTTTTTTGAAGGAAGGAAAGGG + Intronic
916774840 1:167951267-167951289 AGTTATTTTAAGGACAGAAAGGG - Intronic
917382893 1:174434205-174434227 TTTTATATGAAGTTCTGAAATGG - Intronic
918022934 1:180712198-180712220 TTTTATTTAATGGCCACAAAGGG - Intronic
918147280 1:181768146-181768168 TTTTATTTGAAGATGAAAAGGGG - Intronic
918339250 1:183553671-183553693 TTTTTTTGAAAGGTCTGAAAAGG + Exonic
918849793 1:189672247-189672269 TTATATAGGAAGGTCAGAGAGGG - Intergenic
918856913 1:189767743-189767765 TTTAATTTAAAGGAAAGAAAAGG + Intergenic
918857905 1:189782157-189782179 TTTTATTTGAAAGAAAAAAAGGG - Intergenic
919027408 1:192194458-192194480 TTTTATTTTAAGATAAGCAATGG - Intergenic
919234234 1:194817693-194817715 TTTCATTTAAAAGTCAGAAATGG + Intergenic
919381415 1:196866318-196866340 TTTTATCTAAAGAACAGAAAAGG - Intronic
919426774 1:197442154-197442176 TTTATTTTGAAGGTGTGAAAAGG + Exonic
919437203 1:197576516-197576538 TTTAATATGAAGGTAAGAAGAGG + Intronic
919537441 1:198805804-198805826 TTTATTTTCAAAGTCAGAAATGG + Intergenic
921409162 1:214815920-214815942 TTTTTTTTCAAGCTAAGAAAAGG + Intergenic
921605778 1:217152776-217152798 TTTTATTTAAAGTCCAGCAATGG - Intergenic
924361493 1:243246079-243246101 TTTTATTAAAAAGTTAGAAAAGG + Intronic
924687197 1:246306385-246306407 TTTTATTTCAAGGGAAAAAATGG - Intronic
1062994082 10:1848352-1848374 TTTTATATTCATGTCAGAAAGGG + Intergenic
1063226738 10:4022422-4022444 TATTATTTGAAGATGTGAAACGG + Intergenic
1064116910 10:12585949-12585971 TTTTAATTGAAGGTCAGCAGTGG + Intronic
1065010058 10:21412695-21412717 TTTTGTTTGAAGCTCAGAAAAGG + Intergenic
1065742169 10:28806926-28806948 TTTCAGTTGAAGGTCTGGAATGG + Intergenic
1067514994 10:46931776-46931798 TTTTATTTGCAGGTAGTAAATGG + Intronic
1067989359 10:51193144-51193166 TATTAGTTGAATGACAGAAATGG + Intronic
1068322623 10:55439339-55439361 TTATACTTGAAGGTCAGATTAGG - Intronic
1068424462 10:56840621-56840643 TTTTGTTTGAATCTCAGACATGG - Intergenic
1068687424 10:59883325-59883347 TTTCACTTGGAGGTCATAAAAGG - Intronic
1069273798 10:66564706-66564728 TTTTCCTTGAAGGACATAAAAGG + Intronic
1070442805 10:76463310-76463332 TTTTGTTTGAAATTCAGGAAAGG + Intronic
1071047056 10:81392965-81392987 TTTTTTTTGAAGGAGAGACAGGG + Intergenic
1071157704 10:82709875-82709897 TCTGATTTGAAGACCAGAAAAGG - Intronic
1072204558 10:93191427-93191449 TTTTATTTTTAGGACAGACAGGG - Intergenic
1072231848 10:93420485-93420507 TTTTATATGAAGATGACAAAAGG - Intronic
1072275089 10:93815017-93815039 TTTTTTTTAAATGTCATAAAAGG - Intergenic
1072283511 10:93892042-93892064 TTATATATGAAGGTCAGCAGTGG + Intergenic
1072762995 10:98073188-98073210 TTTTATCTGACCCTCAGAAAGGG - Intergenic
1073677974 10:105671297-105671319 ATCTATTTGAATGTCAGTAAAGG - Intergenic
1073785206 10:106881501-106881523 TATTTTTTAAAGGCCAGAAAAGG + Intronic
1073821647 10:107271250-107271272 TTTTACCTGAAGCTCAGCAAGGG - Intergenic
1073862282 10:107760777-107760799 CTTTCTTTGAAGGTTAGGAAAGG - Intergenic
1074369932 10:112892203-112892225 TTTTTTTTTTAGGACAGAAATGG + Intergenic
1075352872 10:121741038-121741060 ATGTATTTGAAAATCAGAAAGGG + Exonic
1075867249 10:125735054-125735076 GTTTATTTGGATGTTAGAAATGG + Intronic
1077838862 11:5950874-5950896 TTTGCTTTGAAAGTCAGATATGG + Intergenic
1078704560 11:13728669-13728691 TTTTATTGCAAGATCACAAATGG + Exonic
1078727453 11:13944231-13944253 TGTGACTGGAAGGTCAGAAATGG - Intergenic
1080132573 11:28814144-28814166 TTTTATTTGAAGGAATAAAAGGG + Intergenic
1080189617 11:29528198-29528220 TTTTATATGATGGTCCCAAATGG + Intergenic
1080329272 11:31116875-31116897 TTTTTTTTTAAGCCCAGAAAAGG + Intronic
1081557938 11:44184412-44184434 TTTGGTTTGAAGGTAAGAAAGGG + Intronic
1083044327 11:59719592-59719614 TTGTTTTTGAAGGTCAGCAATGG + Intronic
1084371565 11:68748557-68748579 TTGTTTTGAAAGGTCAGAAATGG - Intronic
1084539801 11:69778827-69778849 TTTTTTTTGGAGGTCGAAAAAGG - Intergenic
1085490963 11:76916731-76916753 ATTTATTCAAAGGTCAAAAAGGG - Intronic
1085991494 11:81852202-81852224 CTTTCTTTGAAGGTCAGAGATGG + Intergenic
1086281702 11:85196914-85196936 TTTTATGTGAATCTCACAAAAGG - Intronic
1087376933 11:97354333-97354355 CTTTTTTTGAGGGTGAGAAAGGG - Intergenic
1087512889 11:99120679-99120701 TTTAATCTGAAGGTCACACAAGG + Intronic
1087671482 11:101112279-101112301 TTATATTTTAAGATGAGAAAAGG + Intronic
1088002871 11:104903808-104903830 TCTGATCTGTAGGTCAGAAATGG - Intergenic
1088228981 11:107654005-107654027 ATTTATATGGAGGTCAGAAATGG - Intronic
1088947331 11:114527891-114527913 TTTTTTTTGAAGGTCCAAAGTGG - Exonic
1089431788 11:118430906-118430928 TTTTTTTTAAAGCTCAGAAATGG + Intronic
1090547716 11:127783452-127783474 TGTTATTTTAAAGTCAGATATGG - Intergenic
1090620521 11:128556684-128556706 TCTTATTTGAAGGCCAGAAAAGG - Intronic
1091139266 11:133221352-133221374 TGTTATGTGAAGGTGAGAAAGGG - Intronic
1091297269 11:134482743-134482765 TCCTATTTGAGGGTGAGAAATGG - Intergenic
1091901692 12:4149178-4149200 TTTTGCTTGAAGATCAGAGATGG + Intergenic
1092650762 12:10632261-10632283 TTATATATGAAGGTCAAGAAAGG + Intronic
1092838126 12:12511419-12511441 TTTTTTGTGAAGGAGAGAAATGG - Intronic
1093312074 12:17601538-17601560 TTTTATTTGAAACACAGAATAGG - Intergenic
1093670982 12:21875716-21875738 TTTATTTTGTAGGTCACAAATGG - Exonic
1095240428 12:39852546-39852568 TTTTCTTGGAAGGTAACAAAAGG + Intronic
1095734353 12:45540293-45540315 CTTTACTTGAAGACCAGAAAAGG + Intergenic
1095993136 12:48052490-48052512 TTTAATTTGAAAATCAGAATGGG - Intronic
1096249228 12:50016929-50016951 TTATATTCAAAGGTCTGAAATGG - Intronic
1096753171 12:53776243-53776265 TTTTTTTTGAAAGAGAGAAAGGG - Intergenic
1097547913 12:61027907-61027929 TATTATTGGAATATCAGAAAGGG - Intergenic
1097786621 12:63767212-63767234 TTTCATTTGAAGGCCAGGCATGG + Intergenic
1098038080 12:66326729-66326751 TTTTTTTTAAAGGTAAAAAAGGG + Intronic
1099417228 12:82405744-82405766 TTTCATTTGCAGGAAAGAAATGG - Intronic
1100179938 12:92074129-92074151 TTTTATTTTAAGGCCAGGCATGG - Intronic
1100278757 12:93097410-93097432 TTTTCACTGAAGGTCAGCAAAGG + Intergenic
1100352159 12:93794842-93794864 GTATATTTGAAGAACAGAAAAGG - Intronic
1100510901 12:95272283-95272305 TTTTATTAGATGGTAAGAGAAGG + Intronic
1101890499 12:108710473-108710495 TTTTATTTGAAGATAAAAAGAGG - Intronic
1103211503 12:119170446-119170468 TTCCATCTGAGGGTCAGAAATGG + Intergenic
1103628898 12:122243254-122243276 TTTTATTTGATGTTGAGACAGGG + Intronic
1104379617 12:128295624-128295646 TTTTTTTTGAAGGACTTAAAAGG - Intronic
1106692120 13:32129527-32129549 TATTATTTAAATGTCAGAAGGGG + Intronic
1106955881 13:34938514-34938536 TTTTATTTTAAGGCCAGGCATGG - Intergenic
1106974174 13:35186463-35186485 TTATATTTCAATGACAGAAATGG - Intronic
1107180375 13:37451619-37451641 TTATATTTGAAAATCAGAATGGG - Intergenic
1107448384 13:40487792-40487814 TTTAATTTGAAGGTGAAAGAGGG + Intergenic
1108804974 13:54143135-54143157 TTTTGTTTGCAGTACAGAAAAGG - Intergenic
1109201574 13:59437156-59437178 TTCCATTTAAAGGTAAGAAATGG + Intergenic
1109795444 13:67306632-67306654 TTTTATTTGTAAGACAGAACTGG + Intergenic
1110326082 13:74217166-74217188 TTTTTTTTGAAGTAAAGAAAAGG + Intergenic
1110936243 13:81292951-81292973 TTTTACTTGAATGACAGAAAGGG - Intergenic
1111088488 13:83409648-83409670 TTTTAAATGTATGTCAGAAATGG - Intergenic
1111719952 13:91930574-91930596 TTTTTTTTGTAGGACAAAAAAGG - Intronic
1112507991 13:99986674-99986696 TTTTATTTGAAGGTTTTAAGTGG + Exonic
1113366762 13:109683602-109683624 TTTTTTTTAAATGTCAAAAATGG - Intergenic
1113675722 13:112205962-112205984 TTTTATTTTAAGGGGAGAAAAGG - Intergenic
1114161154 14:20169281-20169303 TCTCATTTGAAGGTCAAAATAGG + Intergenic
1115042976 14:28954568-28954590 ATAAATGTGAAGGTCAGAAAAGG + Intergenic
1115731305 14:36272408-36272430 TTTGATTTTACGGTCAGAACTGG - Intergenic
1116186464 14:41606248-41606270 TACTATGTGAAGGGCAGAAAGGG - Intergenic
1117562289 14:56953120-56953142 CTTTATTTGGAGGTCAGTGAAGG - Intergenic
1117997565 14:61492248-61492270 ATTTATTTGAAGGTTAGGTAAGG + Intronic
1119552026 14:75521975-75521997 TTGTGTTTGATGGTCAGGAAAGG + Intergenic
1120902766 14:89590140-89590162 TTTTTTTTTAAGCTCAAAAATGG + Intronic
1121807811 14:96847245-96847267 TTTAATTTGTAGTTCAGAAATGG + Exonic
1124705916 15:31963949-31963971 CTTTAGTTAAAGGTCAGGAAAGG - Intergenic
1125526217 15:40376905-40376927 TTCTGTTAGAAGGTCAGAATTGG + Intergenic
1126063501 15:44806657-44806679 TATTATTTGCTGGGCAGAAATGG - Intergenic
1126170559 15:45692042-45692064 GTTTATTTGAAGTTCAGCAGTGG + Intergenic
1127590082 15:60414000-60414022 TTTCAACTGAAAGTCAGAAAGGG - Intergenic
1127612254 15:60648325-60648347 TTTTAAATGAAGTTGAGAAATGG - Intronic
1127723690 15:61726886-61726908 TGTGTTTTGGAGGTCAGAAAAGG - Intergenic
1127860753 15:62992448-62992470 TCTTATTAGAAGTTCAGACAAGG - Intergenic
1127972334 15:63971412-63971434 TTTGATCTCAAGGTCAGTAAGGG - Exonic
1128140064 15:65293252-65293274 TTTCATTTAAATGTCGGAAATGG + Intronic
1128184395 15:65632134-65632156 TTTTATTTCAAGCTCAACAAGGG + Intronic
1128199177 15:65790708-65790730 TTTTATTTTAAGTTCAAACAGGG + Intronic
1128571032 15:68732925-68732947 TTTGATTTGAAGAGAAGAAAGGG - Intergenic
1128967011 15:72069786-72069808 TTCTAATTGAAAGTCAGAAGAGG - Intronic
1129133014 15:73517756-73517778 GGTTCTTTGAAGGTCAGAGAAGG + Intronic
1129422677 15:75441702-75441724 TTTCATTTGATGGGCAGAAAGGG - Intronic
1130338747 15:82980610-82980632 TTTTATGTGATGGTCAGTCAGGG - Intronic
1130744952 15:86641744-86641766 CTTTTTTTGAAATTCAGAAACGG - Intronic
1131428566 15:92367846-92367868 CTTTCTTTAAAGGTCAGAAAAGG - Intergenic
1133545887 16:6806488-6806510 TTTTATTTACTGGTCAGAATAGG - Intronic
1133546668 16:6814288-6814310 TTCAGTTTGAAGATCAGAAAAGG - Intronic
1133925062 16:10185460-10185482 ACTTATATGAAGTTCAGAAAAGG - Intergenic
1135829186 16:25758532-25758554 ATTTATCTGAACTTCAGAAATGG + Intronic
1135910360 16:26555190-26555212 TCTTATTTGAGGGTTAAAAAGGG - Intergenic
1135978968 16:27131788-27131810 TTTTAATGGAGGTTCAGAAAGGG + Intergenic
1136685472 16:31991900-31991922 TGTTATTTGAAGGCCAGGCATGG + Intergenic
1136706717 16:32195674-32195696 ATTTTTTTGTAGGACAGAAAAGG + Intergenic
1136761194 16:32733743-32733765 ATTTTTTTGTAGGACAGAAAAGG - Intergenic
1136786085 16:32935430-32935452 TGTTATTTGAAGGCCAGGCATGG + Intergenic
1136806909 16:33136643-33136665 ATTTTTTTGTAGGACAGAAAAGG + Intergenic
1136883688 16:33918373-33918395 TGTTATTTGAAGGCCAGGCATGG - Intergenic
1139106928 16:63837247-63837269 TTTTTTTTGGTGGCCAGAAACGG - Intergenic
1139150076 16:64371403-64371425 CTTTATTTGAAGGTAAGGATAGG + Intergenic
1139168255 16:64597371-64597393 TTTTCATGGAAGGTAAGAAAAGG - Intergenic
1139441840 16:66972126-66972148 TTTTATTTTAATCTCTGAAATGG - Intronic
1139903052 16:70343146-70343168 TTCTATTTGAAGTCCAGTAAGGG + Intronic
1140619025 16:76705203-76705225 TTTTATTGGAATCTCAAAAAAGG - Intergenic
1140659997 16:77180219-77180241 TTTTTTTTTAAGCTCAGAGAGGG - Intergenic
1140789551 16:78378050-78378072 GTTGATTTGAAGGTTAGGAATGG + Intronic
1140867210 16:79073617-79073639 TTTTATTAGTAGGTAATAAAGGG - Intronic
1141286385 16:82676369-82676391 TTTTAATTGACTGTGAGAAAGGG - Intronic
1141294624 16:82755911-82755933 TTATATTTGGAGCTCAGAGAGGG + Intronic
1141449199 16:84086095-84086117 TTGGGTTTGATGGTCAGAAAAGG - Intronic
1141484964 16:84332879-84332901 TTTGATTTCAAGGTCATTAAAGG - Intergenic
1141541197 16:84723057-84723079 TCTTATTTGAGGGTCAAAGATGG + Intronic
1203063347 16_KI270728v1_random:994060-994082 ATTTTTTTGTAGGACAGAAAAGG - Intergenic
1203088320 16_KI270728v1_random:1197088-1197110 TGTTATTTGAAGGCCAGGCATGG + Intergenic
1144230942 17:13203126-13203148 TTTTATGTGAAGGTAAGATGAGG + Intergenic
1145121226 17:20261730-20261752 TTTTCTGTGAATATCAGAAAAGG + Intronic
1145202728 17:20961163-20961185 TTTTCTATAAAGGTCAGATAAGG + Intergenic
1145715830 17:27020173-27020195 TCTCATTTGAAGGTCAAAATAGG + Intergenic
1146814958 17:35935308-35935330 TCTAGTTTGAAGCTCAGAAAAGG + Intronic
1147364597 17:39951941-39951963 ATGTCTGTGAAGGTCAGAAATGG - Intergenic
1147555283 17:41475257-41475279 ATTTAACTGAAGCTCAGAAATGG + Intergenic
1147795564 17:43039945-43039967 ACCAATTTGAAGGTCAGAAATGG + Intergenic
1148991464 17:51670190-51670212 TTTAAATTGAAGGTCAGGCAAGG - Intronic
1151056248 17:71034932-71034954 GTATGTTTAAAGGTCAGAAAAGG - Intergenic
1151137945 17:71965705-71965727 TTTTACTTGAATCTCACAAAGGG - Intergenic
1153228721 18:2917231-2917253 TTTTGTTTGAAAGTAAGAAAGGG - Exonic
1153525495 18:5991159-5991181 TTATATTTGAGGGTCAGCATGGG - Intronic
1154090397 18:11354045-11354067 TTTTAGTATAAGGTGAGAAATGG - Intergenic
1154472120 18:14713916-14713938 TCTCATTTGAAGGTCAAAATAGG - Intergenic
1154510670 18:15098212-15098234 TTTTGTTTGCAGGTCAGATTAGG + Intergenic
1155073754 18:22337905-22337927 TTTTAGTTTAAGAACAGAAATGG + Intergenic
1155475034 18:26228897-26228919 TTTTATTTGTTGGTCATAATAGG + Intronic
1155533203 18:26788955-26788977 TTTCATATTAAGGCCAGAAATGG - Intergenic
1155811844 18:30246517-30246539 TTTTATTTGAAGATCAACATTGG + Intergenic
1155823244 18:30405005-30405027 TTTTATTAGAAAATCATAAAAGG + Intergenic
1155884741 18:31193843-31193865 TTTCATTAGAAGTCCAGAAAAGG - Intergenic
1156434393 18:37111512-37111534 TTTTATTTGAAGGTTAAGTATGG - Intronic
1156577860 18:38339400-38339422 TTTAATATGAAGCTAAGAAAAGG - Intergenic
1156685543 18:39641055-39641077 TTTTCTTTCTAGGTTAGAAATGG + Intergenic
1157090438 18:44630522-44630544 TCCTATTTGAAGGTTAAAAATGG - Intergenic
1157330057 18:46697235-46697257 TTTTATTTCAAGGTTAAATATGG + Intronic
1157756918 18:50226782-50226804 TTATATGTGATGGTCAGAAAAGG - Intergenic
1158611850 18:58947700-58947722 TTTTTTTTTAAGATCAGACAAGG - Intronic
1158758163 18:60351311-60351333 TTTTACTTTAATGCCAGAAATGG + Intergenic
1159215031 18:65381456-65381478 ATTTATTTGATGATCAAAAAAGG + Intergenic
1159451637 18:68610209-68610231 TTTTATTGGAATGTCATTAATGG - Intergenic
1159527414 18:69610864-69610886 TGGTATTTGAGGGTCAGAGAAGG + Intronic
1159838120 18:73365389-73365411 TTTTTTCTGAATTTCAGAAATGG + Intergenic
1164914654 19:32042423-32042445 ATTTATTTGAAAGACAAAAAAGG - Intergenic
1166066392 19:40361720-40361742 TTTAATAAGGAGGTCAGAAAAGG - Intronic
1167699608 19:51034706-51034728 TTCTCTTTGAAGGTCACCAAGGG + Intronic
926177420 2:10607320-10607342 GTTTATGAGAAGGTCAGCAAAGG + Intronic
928978083 2:37109840-37109862 ATTCATATGAAGGTCAAAAACGG + Intronic
930135355 2:47897870-47897892 GATTATTTGAAGGCTAGAAATGG - Intronic
930211626 2:48644995-48645017 TTATATTAGAAAGTTAGAAAAGG - Intronic
930329782 2:49967554-49967576 TTTTATTTGAAACTCTAAAATGG - Intronic
930899684 2:56489426-56489448 CATTCTTTGAAGGACAGAAATGG - Intergenic
931593598 2:63914823-63914845 TTTTATTGGTAGGTCACAAAAGG + Intronic
932627794 2:73312723-73312745 TTATAAATGAAGGTGAGAAATGG - Intergenic
932988687 2:76760173-76760195 TTTAATTTGAAAGTAAGAATGGG - Intronic
933162131 2:79037076-79037098 ATTTATCTGTAGGTCAGAAGAGG - Intergenic
933610036 2:84424409-84424431 TTTTATTTGAAGGTGGGGTAAGG - Intronic
935005340 2:99069449-99069471 TTATTTTTGAAGGTGGGAAATGG + Intronic
936113239 2:109682351-109682373 GTTTATTTGAAATTCAGACATGG + Intergenic
937512706 2:122614144-122614166 TTTGATTTGAAGTTAACAAAAGG - Intergenic
938000857 2:127735400-127735422 TTTTATTTGAAGGTCAGAAATGG + Intronic
938505890 2:131882672-131882694 TTTTGTTTGCAGGTCAGATTAGG + Intergenic
939441575 2:142257702-142257724 TTTTATTTGAAAGTCATTTAAGG + Intergenic
939874221 2:147558123-147558145 CTGTATTTGAAGGCCAGAATAGG - Intergenic
939883997 2:147661357-147661379 GTGCATTTGAAGGTAAGAAAAGG - Intergenic
939983811 2:148811488-148811510 TCTTATCTGAAGGTCAGAGAAGG - Intergenic
940201887 2:151160885-151160907 ATTTTTTTAAAGGTCATAAAAGG + Intergenic
940424954 2:153520544-153520566 CTTTATTTTCTGGTCAGAAAAGG + Intergenic
941167244 2:162095871-162095893 TTATTTTTGTAGGTCAAAAATGG - Intergenic
941499106 2:166247300-166247322 TTATATTTGATGTTAAGAAATGG - Intronic
942235475 2:173899769-173899791 CTTTCTTTGAAAGTCATAAAAGG + Intergenic
942342706 2:174965675-174965697 CTTCATTTGAAGGGAAGAAATGG - Intronic
942413728 2:175737119-175737141 TTTTATTTGAGGGACATCAATGG + Intergenic
942660032 2:178254496-178254518 TTAAATCTGAATGTCAGAAAAGG + Intronic
942741288 2:179181503-179181525 TTTCATTTGAACCTCAGAATTGG + Intronic
942810494 2:179994320-179994342 ATTAATTTGAGTGTCAGAAAGGG + Intronic
942816421 2:180058856-180058878 TTTTGTTTGAAAGTCTGAGAGGG - Intergenic
943296731 2:186149841-186149863 TTTTAATGGAAGAACAGAAAGGG - Intergenic
943451604 2:188048916-188048938 TTTAATTAGAATGTAAGAAATGG - Intergenic
943996581 2:194774548-194774570 TTTTGATTGAATGTCAGACATGG + Intergenic
944209285 2:197189658-197189680 TTTTCTTTTAAGGTCCAAAAAGG - Intronic
944518291 2:200534877-200534899 TTTTAACTGAAGATTAGAAAAGG - Intronic
944564620 2:200976358-200976380 TTGTAATCCAAGGTCAGAAATGG + Exonic
945047141 2:205791724-205791746 TTTTAATTTAAGAGCAGAAATGG - Intronic
945300108 2:208208145-208208167 TTTCATTTGCAGGACATAAAGGG - Intergenic
945479250 2:210324978-210325000 TTTCATTAGAAGCTGAGAAAAGG - Intergenic
945546481 2:211159112-211159134 TATTTTTTGAAAGTCAGAACAGG - Intergenic
946133632 2:217627699-217627721 TTTTATTTCAAAGGCAGAAGGGG - Intronic
946455795 2:219824996-219825018 TTTCCTTTGAAGGTGGGAAATGG + Intergenic
947194996 2:227553955-227553977 ATTTTTTAAAAGGTCAGAAAAGG - Intronic
947691208 2:232137916-232137938 TTTGATTTGATGGTGAGAAACGG - Intronic
947964327 2:234266831-234266853 TTTAATTTGAAATTCAGAATAGG + Intergenic
948774790 2:240278528-240278550 ATTTGTTTGAAGGTAAGTAAGGG + Intergenic
1169250612 20:4058068-4058090 TTTTCTTTAAAGAACAGAAAGGG - Intergenic
1170026992 20:11899700-11899722 TTGGATTTGAAGGACACAAAAGG - Intronic
1170076267 20:12422583-12422605 TATTTTTTGTAGGTCAAAAATGG + Intergenic
1170104081 20:12734971-12734993 TTTTATATGGATGTGAGAAAAGG - Intergenic
1170343584 20:15356965-15356987 TTTTGTATATAGGTCAGAAAAGG + Intronic
1170616628 20:17957988-17958010 TTTTTTTTGACGGGCAGAAATGG - Intronic
1170651414 20:18245921-18245943 TTTTATTTGGAAGTTGGAAAGGG + Intergenic
1171480176 20:25449136-25449158 ATTTTTTTAAAAGTCAGAAATGG + Intronic
1172825619 20:37781693-37781715 TCTTACTAGAAGATCAGAAAGGG - Intronic
1173200225 20:40949311-40949333 TTGTATTTGCAATTCAGAAAAGG - Intergenic
1173969444 20:47140440-47140462 TTTTTTTTAAGGGTCAAAAAGGG + Intronic
1173984570 20:47251023-47251045 TTTTTTTTGAAGGAAAAAAAAGG + Intronic
1174951679 20:55049193-55049215 TTTCATTTGAAGGACAAAACAGG - Intergenic
1175045376 20:56100015-56100037 TTTTATAGGATGGTCAGAGAAGG + Intergenic
1176787181 21:13271065-13271087 TTTTGTTTGCAGGTCAGATTAGG - Intergenic
1176787194 21:13271197-13271219 TTTTGTTTGCAGGTCAGATTAGG - Intergenic
1176802372 21:13443992-13444014 TCTCATTTGAAGGTCAAAATAGG + Intergenic
1177431094 21:20993202-20993224 TTCTATTTGAAATTAAGAAATGG - Intergenic
1177593240 21:23201218-23201240 TTTTGTTTGAAAGTCAGATATGG + Intergenic
1177650748 21:23958416-23958438 TTTTCTTTTCAAGTCAGAAATGG + Intergenic
1177986352 21:27979682-27979704 TTTTGTTTGAAGGTCAGATTAGG - Intergenic
1181619076 22:24075759-24075781 TTTTTTTTTAAGTTAAGAAATGG + Intronic
1184354319 22:43968850-43968872 TTTTCTCTGATGGACAGAAAGGG - Intronic
949643341 3:6065264-6065286 TTTTATTAGAATGTCACACATGG + Intergenic
949720454 3:6983478-6983500 TTTTTTTTAAGGGTCAGAAAGGG + Intronic
949779405 3:7669259-7669281 TTAGACTTGAAGGCCAGAAAAGG + Intronic
950982844 3:17327642-17327664 TTTAATATGGAGGTCAGAGAAGG - Intronic
951582750 3:24183184-24183206 ATGTATTTCAAGGTCAGAAAGGG + Intronic
952286321 3:31972883-31972905 TGTTCCTTGAAGGTCAGAGAAGG - Intronic
952523860 3:34189242-34189264 TATTATTTGCTGGGCAGAAATGG + Intergenic
953133270 3:40161213-40161235 TGTTTTTTCAAGGGCAGAAAGGG - Intronic
954041344 3:47889994-47890016 TTTTCTTTGAAAGTAAGAAATGG - Intronic
954784703 3:53084310-53084332 TTTCATTTGAAAATCACAAAAGG - Intronic
955229732 3:57088104-57088126 TTTTATTTTAATGAAAGAAAAGG + Intergenic
955332303 3:58057510-58057532 TTTGATTTGTAGGCCAGTAAAGG + Intronic
955350966 3:58192641-58192663 TTTTATTTAGAGGCAAGAAATGG + Exonic
955488120 3:59455339-59455361 TTTTATATGGAGGTCACCAAAGG - Intergenic
955570428 3:60299225-60299247 GTTTATTTGAAAATCAGCAATGG - Intronic
955860196 3:63321240-63321262 TTGTAGTTAAAGGTCAGAAATGG - Intronic
956236901 3:67082607-67082629 TATTATTTGAAGGTCATCAAAGG + Intergenic
956462123 3:69483086-69483108 TTTTTTTTGTAGTTCAAAAAAGG + Intronic
956990952 3:74764358-74764380 TTTTATTTCAACTTCAGAAAGGG + Intergenic
957168217 3:76703039-76703061 TATTATTTGGAGGGCAGATATGG - Intronic
957290609 3:78273077-78273099 TTTCATTTGAAGGTAAGTACTGG + Intergenic
957402042 3:79728460-79728482 TTAACATTGAAGGTCAGAAACGG - Intronic
957818561 3:85337513-85337535 GGTTATTTGAAAGCCAGAAAGGG - Intronic
958160633 3:89813432-89813454 TTTTATTTGCTTGTCAGAAAAGG - Intergenic
959007557 3:101037710-101037732 CTTTATTTGAAGGTTAGGAATGG + Intergenic
959260956 3:104078943-104078965 TGTCATTTGAATGTAAGAAAGGG - Intergenic
959407453 3:105977520-105977542 TTCTAGTTGAAGGGCAGGAAGGG + Intergenic
960133564 3:114083745-114083767 CTTTAATTGTAGGTCAGAAATGG + Intronic
960221258 3:115111410-115111432 TTTTATCTGAAGGTCACAAACGG + Intronic
960849750 3:122040317-122040339 TTTTATTTCAAGTTGGGAAATGG + Intergenic
960880319 3:122338101-122338123 TATTAATTGAAGGGCAAAAAAGG - Intronic
961476319 3:127148421-127148443 TTTTAGTTGAGGGTAAGGAAGGG - Intergenic
961624217 3:128248632-128248654 TTTTATTTACTTGTCAGAAAAGG + Intronic
962686625 3:137854151-137854173 TTTTATGGCAAGTTCAGAAAAGG - Intergenic
963094843 3:141525102-141525124 TTTTATTTAAAGATCAACAAAGG + Intronic
964218389 3:154315624-154315646 TCCTATTTGTAGCTCAGAAAGGG - Intronic
965237113 3:166138268-166138290 TTTTATTTGAAGGTTATTATCGG - Intergenic
965377271 3:167940819-167940841 TTTTGTATGATGGGCAGAAAGGG - Intergenic
965495361 3:169391248-169391270 TTTTATTTGAAAATGAGCAATGG + Intronic
965547005 3:169926541-169926563 TTTTGTTTTTAGGACAGAAATGG + Exonic
965692161 3:171368945-171368967 TTTTTTTTGACAATCAGAAAAGG + Intronic
965945727 3:174239001-174239023 TTTTAGCTGTAGGTAAGAAATGG - Intronic
966642122 3:182203271-182203293 TTGTTTTTGTAGGTCAAAAATGG - Intergenic
966651728 3:182308643-182308665 TTTTATTTGAATGCCTTAAATGG - Intergenic
967206290 3:187125455-187125477 TGTTATTTGTAGCTCAGAACTGG + Intronic
967308526 3:188083835-188083857 TCATATTTGAAGGTCAATAAAGG + Intergenic
967504305 3:190236613-190236635 TTTTCTTTTAAAGCCAGAAAAGG - Intergenic
970625838 4:17880030-17880052 TTTGCTTAGAATGTCAGAAAAGG - Intronic
970857593 4:20666943-20666965 TTTTCTTGCAAGGTCAGAAAGGG - Intergenic
971046179 4:22807514-22807536 CTTTCTTTGGAGGTCAAAAAAGG + Intergenic
971287594 4:25305715-25305737 TTTTTTTTTAAGGCCAAAAAAGG - Intergenic
971627487 4:28941096-28941118 TATTATTTGAAGAAAAGAAAGGG + Intergenic
971752198 4:30665082-30665104 TTTTATTTTAAAAGCAGAAAAGG - Intergenic
972038312 4:34555276-34555298 TTTAATAAGAAGGTCAGAGAGGG + Intergenic
972100896 4:35414682-35414704 TTTAAGTTGAAGCTCAGCAATGG + Intergenic
972429438 4:38966326-38966348 TTTTAGAGGAAGGTCAGCAAAGG + Intergenic
972728560 4:41769483-41769505 ATTTGTTGGAAAGTCAGAAATGG + Intergenic
972747437 4:41951214-41951236 TTTTATTTAAAGGTCAAATGTGG - Intronic
972988403 4:44793377-44793399 ACTTTTTTGAGGGTCAGAAAAGG - Intergenic
973116180 4:46463019-46463041 TTTTATTTGCAGAACTGAAAGGG + Intronic
973691651 4:53440038-53440060 TTTGATTTGTAGGAGAGAAAGGG - Intronic
973894075 4:55395440-55395462 TTTTTTTTAAAGTTCTGAAATGG - Intergenic
973926090 4:55739061-55739083 TTTTTATTTAAGGTGAGAAATGG - Intergenic
974103551 4:57443058-57443080 TTTTCTATAAAGGCCAGAAAGGG - Intergenic
974146638 4:57956013-57956035 ACTTCTTTGAAGCTCAGAAAAGG - Intergenic
974392818 4:61294858-61294880 TTTAATTTGAAGACCACAAAAGG - Intronic
974539408 4:63214674-63214696 TTTTGTTTAAAGATAAGAAAGGG + Intergenic
974570103 4:63634664-63634686 TTTTATTTAGAATTCAGAAAAGG + Intergenic
974624611 4:64407408-64407430 TTTTATTTGAAGGTAAGACAGGG - Intronic
975537883 4:75471191-75471213 TTTTCTTAGAAGGTCTGCAAAGG - Intergenic
975601405 4:76103835-76103857 TTTTTTTTGAAAGTTGGAAATGG + Intronic
975879090 4:78880902-78880924 TTTTATGTGAAGGTTAGACTTGG + Intronic
976040543 4:80879838-80879860 ATTTATTTGAATATAAGAAATGG - Intronic
976097149 4:81520439-81520461 TTTTATTTAAAAATTAGAAATGG - Intronic
976145096 4:82034574-82034596 TTCTATTTGAAAGGTAGAAAAGG - Intronic
976824195 4:89241231-89241253 TTATTTTTGAAGGTCAGAAAGGG - Exonic
977122400 4:93119589-93119611 TTTTATTTCACAGTAAGAAAAGG + Intronic
977660877 4:99584500-99584522 TTTTATATGAAGTTCTAAAAAGG + Intronic
977941740 4:102867275-102867297 TTTTATTTTACAGTGAGAAAAGG - Intronic
978056709 4:104278569-104278591 TTTTATTTTAAGATGATAAAAGG + Intergenic
978730635 4:112022526-112022548 TTTTTTATGAAGCTCAAAAAAGG - Intergenic
979080095 4:116327773-116327795 TTCTATTTGAAGATTAGAAAAGG + Intergenic
979309594 4:119186322-119186344 TTGAAATTGAATGTCAGAAAAGG - Exonic
980316312 4:131205851-131205873 TCTTATTTCAAGATTAGAAAAGG - Intergenic
980597876 4:134978705-134978727 ATTTATTTCTAGATCAGAAAAGG - Intergenic
980638403 4:135539456-135539478 TTTTATTTTAAGGATTGAAATGG + Intergenic
980824229 4:138054132-138054154 GTATATGTGAAGGACAGAAAAGG - Intergenic
982026999 4:151260903-151260925 CTTTATTGGATGGTCAGGAAAGG - Intronic
982722759 4:158876377-158876399 GTATATTTGAAGGACATAAAAGG - Intronic
982869856 4:160565128-160565150 TTATATGTTAATGTCAGAAACGG - Intergenic
983305771 4:165984540-165984562 TGTCATGTGAAGGTCTGAAAAGG - Intronic
983307753 4:166014916-166014938 CTTTATTTGAACTTCAGAATTGG + Intronic
983403191 4:167291688-167291710 TTTTTTTTCATGGTTAGAAATGG - Intergenic
983567528 4:169169650-169169672 TTTTGTTTAAAGGTGAGAGAAGG + Intronic
983807084 4:172007803-172007825 ATTTAGTTTAAGGACAGAAAAGG - Intronic
983843969 4:172493607-172493629 TTTTTTTTAAAGGTCAGTTAAGG - Intronic
984124218 4:175786262-175786284 TCTTTTTTGAAGGTCAGGAAAGG + Intronic
984446283 4:179840868-179840890 TTGGAATTGAAAGTCAGAAATGG - Intergenic
986062428 5:4204073-4204095 TTTTATAAGGAGGTCAGATATGG - Intergenic
986856708 5:11877073-11877095 TTTTATTTTTGTGTCAGAAATGG + Intronic
987074836 5:14371530-14371552 TTTTATTTGTATTTCTGAAAGGG - Intronic
988954268 5:36298514-36298536 TATTATGTGAAGTTCAGCAAAGG - Intronic
989110812 5:37905223-37905245 TTTTAGAGGAAGGTCAGTAACGG + Intergenic
989147199 5:38260559-38260581 TTTTATTTGAAGCATAGATAGGG + Intronic
989624697 5:43418075-43418097 TTGTATTTGAAGGAGAGACAGGG + Intergenic
990049928 5:51485129-51485151 TTTTATTTGAAGGTGGGGTAGGG + Intergenic
990137789 5:52668408-52668430 TGATATTTGAATCTCAGAAATGG + Intergenic
990683387 5:58271431-58271453 TTTTATATTAAGGACAAAAATGG + Intergenic
991271965 5:64794769-64794791 TTTTATTTGAATGTCTGTATTGG + Intronic
993079913 5:83283138-83283160 TATTATTTGAATGCCAAAAATGG - Intronic
993210087 5:84938285-84938307 ATTTATCTAAAGGTCAGATATGG + Intergenic
993782288 5:92082284-92082306 TTTCACTTCAAGGTCAGGAAGGG - Intergenic
993911165 5:93686510-93686532 ATTTTTTTTAAGGTAAGAAAGGG - Intronic
993919010 5:93776911-93776933 TTTAATCTGAAAGTCAAAAATGG - Intronic
994076993 5:95664038-95664060 CTGTTTTTGCAGGTCAGAAAGGG - Exonic
994260277 5:97650296-97650318 GTTTATTTGTAGGGTAGAAATGG + Intergenic
995096788 5:108245777-108245799 TTAAATTAGAAGGTCAGAAAGGG + Intronic
995856604 5:116599188-116599210 TATTCTTTGAAGGTCATTAATGG + Intergenic
996513250 5:124341398-124341420 TTTCATATGAAGGACACAAAGGG - Intergenic
997307511 5:132849914-132849936 AATTATTTGTAGGTCACAAAGGG + Intergenic
997347026 5:133199431-133199453 GTTTATTTGCAGGTCATACAGGG + Exonic
998891920 5:146755344-146755366 TTTTACTTGAAGGTGATCAAAGG - Intronic
998895229 5:146791854-146791876 TTTTACTTGAGGATAAGAAAAGG - Intronic
999716630 5:154366322-154366344 TTTTATTTTAAGGTATTAAAGGG + Intronic
1000060337 5:157649914-157649936 ATTTTTTTGAAAGTCAGAGAAGG + Intronic
1000115170 5:158147347-158147369 TTTTCATTGAAGGTCAGATGAGG - Intergenic
1000287877 5:159843401-159843423 TTATGTTTGAAGGTCAAGAATGG - Intergenic
1000549661 5:162644667-162644689 TTCTATTTGAAGTTCCCAAAAGG - Intergenic
1000942475 5:167378909-167378931 TTTTATTGGAAATCCAGAAAGGG + Intronic
1000990833 5:167909972-167909994 TTTTTTTTGAAGGGCAGATTGGG + Intronic
1003855486 6:10269487-10269509 TTATATTTTAATGTTAGAAAAGG - Intergenic
1005392904 6:25351420-25351442 CTGTATTTGATGGTAAGAAAGGG + Intronic
1007027301 6:38589393-38589415 TTTGATTTGAAGTGCTGAAAAGG - Intronic
1008085162 6:47236663-47236685 ATTTGTCTGTAGGTCAGAAAGGG - Intronic
1008203371 6:48620390-48620412 TATTGTTTGAAGTTCAAAAAGGG - Intergenic
1008873113 6:56296263-56296285 TTTTAAATGAAGATAAGAAATGG + Intronic
1009024495 6:57982643-57982665 TTTTATATGAAGTAAAGAAATGG - Intergenic
1009200076 6:60734114-60734136 TTTTATATGAAGTAAAGAAATGG - Intergenic
1009576517 6:65469148-65469170 TTAAATTTGAATTTCAGAAAAGG - Intronic
1010139583 6:72598963-72598985 TTTACTTTGAAGGTGGGAAAAGG + Intergenic
1010225074 6:73481420-73481442 TTTTATTTGCAAGTGGGAAAAGG + Intronic
1010647741 6:78412881-78412903 TTTTATTTTTAAATCAGAAAGGG - Intergenic
1010873700 6:81074101-81074123 TTTTATTTTAGGTTCACAAAGGG + Intergenic
1011316811 6:86042078-86042100 TTTTAAATCAAGGTCAAAAAAGG - Intergenic
1012022734 6:93945720-93945742 TTTTATTTAAAGAGCAGACAAGG - Intergenic
1012133523 6:95525503-95525525 TTATTTTTAAAGGTCATAAAAGG + Intergenic
1013494438 6:110684408-110684430 TTCTATTTCAAGGAGAGAAAAGG - Intronic
1013812626 6:114061957-114061979 TTTTTTTTTAAGGGCAAAAAGGG + Intronic
1013981469 6:116134647-116134669 TATTATTTTAAGGTAAGGAAAGG - Intronic
1014470742 6:121811549-121811571 TTTTTTTTAAAGGTTAAAAAAGG + Intergenic
1014558150 6:122858058-122858080 TTTTTTTTTCAGGGCAGAAATGG - Intergenic
1014880204 6:126714570-126714592 TTTAATTTAAAGGAGAGAAATGG - Intergenic
1014972696 6:127837129-127837151 TTATATTGGAAGGTCAGGGACGG - Intronic
1015028554 6:128567206-128567228 TTTTATTTCAGGGTCATAAAAGG + Intergenic
1015264102 6:131272473-131272495 TTATATTAGAAAGTAAGAAAAGG - Intronic
1016012466 6:139152319-139152341 TTTAATTTCAAAGTAAGAAAAGG + Intronic
1016101699 6:140109743-140109765 ATTTCTTTGAAGGACATAAATGG + Intergenic
1017121211 6:151025456-151025478 TTTAATTTGAAGTACAGGAAAGG + Intronic
1018215731 6:161525529-161525551 TTTTATTATAAGATCAGAGAAGG + Intronic
1020440751 7:8214195-8214217 TTTTTCTTGAAAGTCAGAAATGG - Intronic
1020947097 7:14625361-14625383 TTTTATATGAGGGACAGGAAGGG + Intronic
1021144851 7:17072778-17072800 TCTTTTTTCAAGGTCACAAATGG + Intergenic
1021460477 7:20881166-20881188 TTTTATTTGAGGGTAGTAAATGG + Intergenic
1021543430 7:21786385-21786407 TTTTTCTTGAAGGCAAGAAAGGG + Intronic
1021866814 7:24966309-24966331 TCTTATCTGTGGGTCAGAAAAGG + Intronic
1021887070 7:25149848-25149870 TATGAATTGAAGCTCAGAAAAGG + Intronic
1022256580 7:28664306-28664328 TTTTACTTGAAGGGCTGAATTGG - Intronic
1022289979 7:28991351-28991373 TTTTATATGAAAGAAAGAAAAGG - Intergenic
1022533575 7:31081982-31082004 CTTTATTTGAAGTCCACAAAGGG - Intronic
1022904920 7:34846388-34846410 TTTTATTTCAAGGTGGGAAAGGG - Intronic
1023304449 7:38809598-38809620 TTTTACCTGAAGGACAGAGATGG - Intronic
1023357700 7:39383984-39384006 TTTAATTTGAATGTGATAAATGG + Intronic
1024143118 7:46481722-46481744 TCTTCTTTAAAGGACAGAAATGG - Intergenic
1024352231 7:48378168-48378190 TCATATTTGAAGGGAAGAAAAGG + Intronic
1024855535 7:53774084-53774106 TTTTTTTTAAAGCACAGAAAGGG + Intergenic
1025965375 7:66265109-66265131 TCTAATTTGAAGAACAGAAAAGG + Intronic
1026422680 7:70256988-70257010 TTTTCTTAGAAGATCAGGAAAGG - Intronic
1026572341 7:71542195-71542217 TTTAATTTGCAAATCAGAAAAGG - Intronic
1026632478 7:72049362-72049384 TTTTTTTTGGAGCTAAGAAAGGG + Intronic
1027343597 7:77235332-77235354 TTAGATTTGGAAGTCAGAAAAGG + Intronic
1027753059 7:82176145-82176167 TTTTTTCTGAAGGGCAGAGAAGG + Intronic
1028468773 7:91182070-91182092 TATCATTTTAAGATCAGAAAGGG - Intronic
1030702006 7:112650586-112650608 TTTTATTTTAAGCTCATAATAGG - Intergenic
1030969867 7:116043615-116043637 TTTTATTTGAGAGTAAGAAATGG - Intronic
1031034558 7:116774131-116774153 TTTTATTTCAGGGGAAGAAATGG - Intronic
1031140280 7:117935363-117935385 CTTTATTTGAAGGCCAGGTATGG + Intergenic
1031710396 7:125038408-125038430 ATTTATTTAAAAGTCAAAAAAGG + Intergenic
1031742352 7:125450699-125450721 TTTTATTAGAAACTGAGAAACGG - Intergenic
1031752074 7:125588174-125588196 CTTTTCTTGATGGTCAGAAAGGG + Intergenic
1031791458 7:126110322-126110344 TTTTATTTGAAGGTAATATGTGG + Intergenic
1033289529 7:140071578-140071600 TTTTATTGCAAGCTGAGAAAGGG - Intergenic
1033881433 7:145888213-145888235 TTTTATTTGATAGTCATATATGG + Intergenic
1033916714 7:146335163-146335185 TTTGATGTGAAGTTCAGAACAGG - Intronic
1034007921 7:147494744-147494766 TTTAATTTGAAGATAAGGAACGG + Intronic
1034718591 7:153266460-153266482 TTTCATTTTCAGGCCAGAAAGGG - Intergenic
1034786410 7:153929788-153929810 ATTTATTTGATTGTCAGACAGGG + Intronic
1034893640 7:154860896-154860918 TTTTATCTCCAGGTCTGAAATGG - Intronic
1036175264 8:6531698-6531720 TATTATTTGAGGCCCAGAAAAGG + Intronic
1036784392 8:11676341-11676363 TTTAATTTGAAGTTCAGTACCGG + Intergenic
1037005364 8:13772278-13772300 TTTTATATGAAAATCAAAAAAGG + Intergenic
1038019379 8:23540133-23540155 TCTCCTTTGAAGGTGAGAAAAGG + Intronic
1038080193 8:24126086-24126108 TTTTCTCTGAAGGTCAGACAGGG - Intergenic
1038908695 8:31937481-31937503 TTTTATTTGAATTTAAAAAATGG + Intronic
1038970581 8:32629112-32629134 TTTTATTTGAAGTGCAGACCTGG + Intronic
1039247575 8:35626201-35626223 TTTTTTTTAAAGGTAAGGAAAGG + Intronic
1039416057 8:37394883-37394905 ATTTATTTGAAGGATATAAAGGG - Intergenic
1039806472 8:41004251-41004273 TTTGTTTTGAAGCTCAGAAAAGG - Intergenic
1040795145 8:51282045-51282067 CTTAATTTGAAGCTCAAAAAGGG + Intergenic
1041776038 8:61523756-61523778 TTTTATTTTATTGTCATAAAGGG - Intronic
1041840724 8:62267578-62267600 TTCTATTTGAAGGATAGAAAGGG + Intronic
1041842364 8:62286962-62286984 TCTTATATGAAGGGCTGAAAGGG + Intronic
1041855083 8:62443553-62443575 TTATATTTTTAGTTCAGAAAGGG + Intronic
1042079551 8:65036336-65036358 TTTTATTTTGAGGACAGAAGAGG - Intergenic
1042182658 8:66107381-66107403 TGTTGTTTCTAGGTCAGAAAGGG - Intergenic
1042419987 8:68576010-68576032 TGTTATTTGGACGTCAGAAATGG + Intronic
1042819185 8:72911560-72911582 TTTTATTTGAAGGCCATAATGGG - Intronic
1043039907 8:75250172-75250194 TTTTTTTTCAAATTCAGAAAAGG + Intergenic
1043533389 8:81174408-81174430 TTTTATTCCAAGGTCAGTAAAGG + Intergenic
1044883487 8:96748961-96748983 ATTTCTATGAGGGTCAGAAAAGG - Intronic
1045283124 8:100766619-100766641 TTTAATATAAAGGTCAGAGAAGG + Intergenic
1046311811 8:112447484-112447506 TATTATATGAAGGTTAAAAAGGG - Intronic
1046653923 8:116873330-116873352 ACTTATTTGAAGATCAGATATGG + Intronic
1047070549 8:121338166-121338188 TTTTATTTGAAGGGCCAAAATGG - Intergenic
1047870256 8:129074566-129074588 TTATAATTGAAGGCAAGAAAAGG - Intergenic
1048438388 8:134439484-134439506 TTATAGTAGAAGGTCAGAAATGG + Intergenic
1048615311 8:136067614-136067636 TTTGATTTTATGGTCAGACAGGG - Intergenic
1048749070 8:137650339-137650361 TTTTATTTTTAGGTTACAAAAGG + Intergenic
1050743714 9:8852713-8852735 TTTGATTTGAAGGACAGCAGAGG + Intronic
1050819398 9:9858815-9858837 AGTTATTTGTAGTTCAGAAAAGG + Intronic
1051222909 9:14869125-14869147 TTTCATTTCAAAGTCAGACAAGG + Exonic
1051564611 9:18483408-18483430 TGTTATTTAAAGGTCCTAAAGGG - Intronic
1051635005 9:19173643-19173665 TTTTCTAGGAAGGTCAGATAAGG + Intergenic
1053853336 9:42312527-42312549 TTTTTTATGAAAGCCAGAAAAGG - Intergenic
1054803120 9:69372155-69372177 TTTTCTTTTAAGTTCAGAGATGG - Intronic
1055281934 9:74684269-74684291 TTTTATTTCAAAGGCTGAAATGG + Intronic
1055717062 9:79129409-79129431 TTTTATTCAAAATTCAGAAAGGG - Intergenic
1055805430 9:80087783-80087805 TTTTATAGGAAGGTCAGGGATGG + Intergenic
1059106661 9:111517836-111517858 TTTTTTTAGAATGTCATAAATGG + Intergenic
1059144683 9:111888286-111888308 TATTTTTTGAAGCTCAGAATTGG - Intergenic
1059153825 9:111972485-111972507 CTTTATTTTAATGTAAGAAAGGG + Intergenic
1059421337 9:114194393-114194415 TTTTGTTTCAGGGACAGAAAGGG + Exonic
1059637297 9:116183532-116183554 TCTTATTTTAGGGTCTGAAAGGG - Intronic
1060139365 9:121194372-121194394 GTCTATTTGAGGGTAAGAAATGG - Intronic
1060243877 9:121927640-121927662 TTTTTTTTGAAGGTGGGAGAAGG + Intronic
1060702149 9:125764666-125764688 TGTTATTTTAAGATCCGAAATGG + Intronic
1060797009 9:126519444-126519466 TTTTTTTTGCTGGTCAAAAATGG - Intergenic
1060838808 9:126778246-126778268 TTTTTTATAAAGCTCAGAAATGG - Intergenic
1186733987 X:12441453-12441475 TATTATTTGAAGGAGAGAGAAGG - Intronic
1190007325 X:46753030-46753052 TATTATTTGAAAGTTATAAATGG - Intronic
1190224778 X:48536817-48536839 TTTTCTCTGAAAGCCAGAAAAGG - Intergenic
1190259251 X:48787752-48787774 TGGAATTTGAAGGTCAGATATGG - Intronic
1190976535 X:55408053-55408075 TTTTATTTAAAGGTTTGCAATGG + Intergenic
1191009041 X:55741935-55741957 TTTTATTTGAAGATTAGGTATGG - Intronic
1191872233 X:65757521-65757543 CTTTATATGAAGTTCAAAAAAGG - Intergenic
1192239117 X:69315395-69315417 TTGCATTTGAAGGTTGGAAAGGG - Intergenic
1192564713 X:72154010-72154032 TTGGAGATGAAGGTCAGAAAAGG + Intergenic
1192780440 X:74288689-74288711 TTCTGTTTAAAGGTCAGACAAGG + Intergenic
1194429334 X:93781658-93781680 TTTAATTTGAAGTTCACAATAGG + Intergenic
1194885897 X:99315855-99315877 TTTGATTTGTAGATCAGACATGG + Intergenic
1195500186 X:105588397-105588419 TTTTATTTGAGGTTCAGGGATGG + Intronic
1196421832 X:115530490-115530512 TTTTATTTCAAGTTAATAAAAGG - Intergenic
1197104584 X:122699131-122699153 CTTTATTTGAATGACAGAATGGG - Intergenic
1197258959 X:124295468-124295490 TTTCATGTTAAGTTCAGAAATGG + Intronic
1199393005 X:147303549-147303571 TTTTTTTTAAAGGTGAGAAATGG - Intergenic
1200307287 X:155040285-155040307 TTTTATTTGGAGGTGATAAAAGG - Intronic
1201686635 Y:16711825-16711847 TTCCATTTGAAGTTCAGCAATGG - Intergenic
1201931754 Y:19357754-19357776 TTTTTGTTGATGGTCAGAACTGG + Intergenic