ID: 938003320

View in Genome Browser
Species Human (GRCh38)
Location 2:127764958-127764980
Sequence GGCTCACGACAGCCCAGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938003320_938003323 7 Left 938003320 2:127764958-127764980 CCCTCACTGGGCTGTCGTGAGCC 0: 1
1: 0
2: 0
3: 20
4: 205
Right 938003323 2:127764988-127765010 GCAGAAAACATTAATTAGTAAGG 0: 1
1: 0
2: 1
3: 22
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938003320 Original CRISPR GGCTCACGACAGCCCAGTGA GGG (reversed) Exonic
900595839 1:3479773-3479795 GCCTCCCGACAGCCCTGTGATGG + Intronic
903356786 1:22753419-22753441 GGACCATGACAGCCCAGTGCAGG - Intronic
903741966 1:25563583-25563605 GGGCCAGGACAGCCCAGGGAGGG + Intronic
903926506 1:26834303-26834325 TCTTCACAACAGCCCAGTGAGGG + Intronic
904166831 1:28561982-28562004 GGCTCACCTGAGCCCAGGGAGGG + Intronic
904821388 1:33246868-33246890 GGCTCAAGCCAGACCAGTGAGGG + Intergenic
904833228 1:33319073-33319095 GGCACACCACAGCCCCTTGAAGG + Intronic
905207659 1:36352084-36352106 GGCTCTCCACAGCCCAGGGCTGG + Intronic
906065221 1:42975645-42975667 TCCTCACCACAGCCCTGTGAGGG - Intergenic
908237503 1:62161035-62161057 GGCTCATGACAGCACAGTTAAGG - Exonic
915488981 1:156241191-156241213 GCCTCAGGTCAGCCCAGAGAGGG - Intronic
917503500 1:175606987-175607009 GGCTCAGGAGAGCCTAGTAAGGG - Intronic
918433646 1:184487851-184487873 GTCTCACAACAGCCCTATGAAGG - Intronic
921124920 1:212168960-212168982 GGCTAACCACCACCCAGTGAGGG + Intergenic
923758086 1:236812138-236812160 GGCTCACGCCAGCACTGTGGGGG - Intronic
1063155230 10:3373097-3373119 GTCTCATCACAACCCAGTGAGGG + Intergenic
1063504143 10:6580551-6580573 GGCCCAGGACAGCCCCGGGAGGG + Intergenic
1065818062 10:29500091-29500113 GGCTCAGGACAGGCCTGGGATGG + Intronic
1069741795 10:70689616-70689638 GGCTCACACCACCCCAGTGCTGG - Intronic
1070715125 10:78714547-78714569 GCATCACCACAGCCCACTGAGGG - Intergenic
1073381213 10:103079317-103079339 GGCTCCCCACAGCTCAGGGAAGG - Exonic
1075737368 10:124672296-124672318 GGCTGTTGAGAGCCCAGTGAGGG - Intronic
1076055347 10:127367994-127368016 GGCACAAGAGTGCCCAGTGATGG - Intronic
1076809885 10:132880915-132880937 GGATCTCGACAGCCCAGCGGAGG + Exonic
1076830070 10:132989626-132989648 GGCTCCCGAGAGCCGAGTGGAGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077105412 11:840169-840191 GGCTCCTGACATCCTAGTGAGGG + Exonic
1079423888 11:20321678-20321700 TCCTCACAACAGCCCTGTGATGG + Intergenic
1081163997 11:39786119-39786141 TGCTGAGGACAGCCCAGTGCTGG - Intergenic
1083871740 11:65492547-65492569 GCCTCACAACAGCCCTGTGGGGG - Intergenic
1084531878 11:69732248-69732270 GGCTGACCACAGCGCAGAGATGG - Intergenic
1085392769 11:76190931-76190953 GGCTCAGGACAGGAGAGTGAGGG - Intronic
1090882091 11:130842615-130842637 GGCTCACAAAGCCCCAGTGAAGG - Intergenic
1093741430 12:22693467-22693489 GGCTCTGGCCAGCCCAGAGAGGG + Intergenic
1094395970 12:30006314-30006336 GGCTCCTAACAGCCCAGAGAAGG - Intergenic
1098141769 12:67457339-67457361 GCTTCACAACAGCCCAGTGGGGG - Intergenic
1098457621 12:70692864-70692886 GGCTCACCACACTCCATTGAGGG - Intronic
1100587060 12:95990289-95990311 TCCTTACAACAGCCCAGTGAGGG - Intronic
1102544545 12:113645313-113645335 GGCTGATGCCAGCCAAGTGATGG + Intergenic
1102929419 12:116851054-116851076 TCCTCACAACAGCCCTGTGATGG + Exonic
1104730922 12:131104919-131104941 GACTCACGACAGCACGGCGAAGG - Exonic
1104735155 12:131131977-131131999 GGGTCACGAGAGCCAAGCGAGGG - Intronic
1104847591 12:131854485-131854507 GACCCACGCCACCCCAGTGAGGG + Intergenic
1105410700 13:20168923-20168945 TCCTCACAGCAGCCCAGTGAGGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1119432392 14:74576933-74576955 TTCTCACAACATCCCAGTGAGGG + Intronic
1121600454 14:95199442-95199464 GGCTCATCAGAGCCCAGTGAGGG - Intronic
1121644455 14:95508223-95508245 TCCTCACAACAGCCCAATGAAGG - Intergenic
1122150359 14:99722209-99722231 GTCTCACCATAGCCCTGTGAGGG + Intronic
1122453397 14:101830441-101830463 GGCTGAGGACAGCCAAGTGTTGG + Intronic
1122881170 14:104691016-104691038 GGCCCATGACAGTCCAGGGATGG - Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1123722716 15:23073923-23073945 TGCTCACAGCAGCCCTGTGATGG - Intergenic
1123930754 15:25170651-25170673 GGCTCACCACAGCTCAGTGCAGG - Intergenic
1123931217 15:25172563-25172585 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123932902 15:25180425-25180447 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123934473 15:25187464-25187486 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123936108 15:25194850-25194872 GGCTCACCACAGCTCAGTGCAGG - Intergenic
1123936707 15:25197498-25197520 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123939056 15:25208012-25208034 GGCTCACCACAGCTCAGGGCAGG - Intergenic
1123939891 15:25211723-25211745 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123940746 15:25215470-25215492 GGCTCACCACAGCTCAGTGCAGG - Intergenic
1123941161 15:25217327-25217349 TGCTCACCACAGCACAGTGCAGG - Intergenic
1123944462 15:25232316-25232338 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123946129 15:25239766-25239788 GGCTCACCACAGCTCAGTGCTGG - Intergenic
1123947396 15:25245406-25245428 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123947792 15:25247273-25247295 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123948225 15:25249132-25249154 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123948605 15:25250799-25250821 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1128475830 15:67996126-67996148 GCCTCAAGACAGCCCTGTGAGGG - Intergenic
1128567851 15:68713125-68713147 GGCCCAAGACAGCTCAGTTAAGG + Intronic
1132221261 15:100107329-100107351 GGCTCACCACAGTTCTGTGAGGG + Intronic
1132828402 16:1916222-1916244 GGCTCTGCACCGCCCAGTGAGGG + Intronic
1135141156 16:19923279-19923301 GGCCCAGGGCTGCCCAGTGAGGG - Intergenic
1135629073 16:24021800-24021822 TTCTCCTGACAGCCCAGTGATGG - Intronic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1137389370 16:48068657-48068679 GGCTCAGGACATCTCTGTGAGGG + Intergenic
1138452427 16:57101620-57101642 GGCTGACCACACCCCAGGGATGG - Intronic
1142757034 17:2022727-2022749 GGCTGAGCCCAGCCCAGTGAAGG + Intronic
1143033669 17:3982312-3982334 GGCTCACGAGAGGCCTGTGGTGG + Intergenic
1146889392 17:36496248-36496270 GGATCACCCCAGCCCAGTGAAGG + Exonic
1153041115 18:813115-813137 TGCTGGCGGCAGCCCAGTGAGGG + Intergenic
1153795676 18:8619756-8619778 GCCTCACAGCAGCCCAGTGACGG - Intronic
1153879038 18:9404588-9404610 GGCTATCTTCAGCCCAGTGAGGG - Intergenic
1154209412 18:12366635-12366657 GGCACACGACAGCACAGAGCAGG + Intronic
1156445879 18:37236389-37236411 GGCCCAGGACAGCCCAGAGGAGG - Intergenic
1157177559 18:45465434-45465456 GGCCCAGGACAGGGCAGTGAAGG + Intronic
1158020462 18:52836063-52836085 GGCTAATGAGTGCCCAGTGAAGG + Intronic
1160340811 18:78087347-78087369 GGCTCATGACAGCCCAGTTCAGG - Intergenic
1160779477 19:871457-871479 GTCTCATGACAGGCCAGAGACGG - Intronic
1163405760 19:17121296-17121318 TCCTCACCACAGCCCACTGAAGG + Intronic
1163622962 19:18371702-18371724 GGCTCAAGACAGCAAAGGGACGG - Intergenic
1163889831 19:20000916-20000938 CTCTCACCACAGCCCAGTGCTGG - Intronic
1165708281 19:37991701-37991723 CACTCAAGACAGCCCTGTGACGG + Intronic
1166342071 19:42144112-42144134 GGCTCCATCCAGCCCAGTGATGG - Intronic
1167373545 19:49099188-49099210 CCCTCACTACTGCCCAGTGAAGG - Intronic
1167431053 19:49454595-49454617 GGATCATGAGAGCCCCGTGAAGG - Intronic
926107511 2:10161502-10161524 GGATCTCCCCAGCCCAGTGAGGG + Intronic
926675746 2:15618753-15618775 GGCTGAGGACGGCCCAGTGCTGG - Intronic
927469565 2:23362831-23362853 GGCTCAGGACAGCACAGAGGTGG + Intergenic
928050980 2:27995147-27995169 GGCCCACAGCACCCCAGTGAAGG - Intronic
928125892 2:28615593-28615615 GGCTCACGTTAGCCCAGTGGAGG + Intronic
929950960 2:46409158-46409180 GCCTCACAATAGCCCAGCGAGGG - Intergenic
932615693 2:73230043-73230065 GGGTCACTGCAGCTCAGTGAGGG + Intronic
932818349 2:74879265-74879287 GGACCACCCCAGCCCAGTGAGGG + Intronic
937111232 2:119368097-119368119 GCCTGATGACAGCCCAGTTACGG - Intronic
937924906 2:127160600-127160622 GGCCCAGGATAGCGCAGTGATGG + Intergenic
938003320 2:127764958-127764980 GGCTCACGACAGCCCAGTGAGGG - Exonic
941618778 2:167753756-167753778 GCTTCACCACAGCCCAGTGTGGG + Intergenic
945224716 2:207521859-207521881 TCCTCACAACAACCCAGTGAGGG - Intergenic
947049960 2:226031125-226031147 GGGTCACGCCAGCACAGTGGAGG - Intergenic
948450697 2:238069368-238069390 TGGGCACCACAGCCCAGTGAAGG + Exonic
1170994694 20:21341300-21341322 TGCTCACAACTGCCCACTGAAGG - Intronic
1171409338 20:24935586-24935608 GGCTCCCACCAGCCCAGGGAAGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172114418 20:32565096-32565118 GCCTCAGGACAGCTCTGTGAGGG - Intronic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1177212435 21:18087501-18087523 GTCTCACGGCAGCCCATTGCAGG + Intronic
1179843256 21:44091320-44091342 GGCTCCCCAAAGGCCAGTGAGGG + Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1183235214 22:36611655-36611677 GGCTCAAGAGATCCCAGTGGAGG - Intronic
1183776101 22:39966870-39966892 TCCTCACAACAGCCCAGTGAGGG - Intronic
1184343371 22:43898296-43898318 AGCTGTTGACAGCCCAGTGATGG + Intergenic
1184384749 22:44167620-44167642 AGCTCCCAACAGCCCAGTGGAGG - Intronic
1184798602 22:46746733-46746755 GGCTCACAGCACCCCAGGGAAGG + Intergenic
1185095163 22:48802465-48802487 GGCCCAGAGCAGCCCAGTGATGG - Intronic
949777894 3:7652561-7652583 GGCTAACAACAGCCTTGTGAAGG - Intronic
950560385 3:13718095-13718117 GGGGCACCACAGCCCAGAGAGGG - Intergenic
951184918 3:19702511-19702533 GGCTTCCGCCAGCCCAGTGAGGG - Intergenic
952769077 3:36981114-36981136 GGATCACTTGAGCCCAGTGAAGG - Intergenic
954870517 3:53764253-53764275 AGCTCAGGGCAGCCCAGTTAGGG - Intronic
956219182 3:66884007-66884029 GGGTCCAGACAGCCAAGTGAGGG - Intergenic
957729226 3:84110972-84110994 GAATCAGGACAGCACAGTGATGG + Intergenic
959252499 3:103966042-103966064 GGCTTAGGACAGCTCAGTGTGGG + Intergenic
959560083 3:107769356-107769378 GCCTCACAACAGCCCAATGTAGG + Intronic
960696791 3:120404143-120404165 GCCTCATGATATCCCAGTGAAGG - Intronic
961475775 3:127145444-127145466 GGCTGCCCAGAGCCCAGTGAGGG - Intergenic
966471898 3:180299037-180299059 AGCAAATGACAGCCCAGTGATGG - Intergenic
967301321 3:188016887-188016909 GTTTGAGGACAGCCCAGTGAGGG + Intergenic
971258160 4:25031818-25031840 GGCTCAGGAGGGCCCAGTTAAGG - Intergenic
975670081 4:76771735-76771757 TCCTCACAACAGCCCAGTGAGGG + Intronic
985391789 4:189497995-189498017 GGCCTGCGCCAGCCCAGTGATGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985780713 5:1869462-1869484 GGCTCCCGGCAGGCCGGTGAGGG - Intergenic
986195642 5:5534597-5534619 ACCTCACGACAGCCCAGAGGTGG - Intergenic
987342666 5:16952454-16952476 TGTTCATGTCAGCCCAGTGAGGG + Intergenic
997626655 5:135335828-135335850 GGCACACCACAGAGCAGTGAGGG - Intronic
999189951 5:149739824-149739846 TGCTCAGGACTACCCAGTGAGGG + Intronic
1006361604 6:33590193-33590215 GGCCCAGGCCAGCCCAGTGAAGG + Intergenic
1006694791 6:35921470-35921492 GGCTCACAATAGCTCAGGGAAGG - Intergenic
1007382226 6:41497941-41497963 AGCACACTACAGCCCAGAGAAGG + Intergenic
1013174211 6:107663529-107663551 TTCTCACGTCAGCCCAGTGAGGG + Intergenic
1019137779 6:169922107-169922129 GTCTCAGGAGAGCCCTGTGAAGG + Intergenic
1019214685 6:170435513-170435535 GTCTCACAACAGCCCAGCCAAGG - Intergenic
1019275256 7:172743-172765 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275268 7:172773-172795 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275280 7:172803-172825 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275305 7:172863-172885 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275317 7:172893-172915 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275329 7:172923-172945 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275341 7:172953-172975 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1024608246 7:51040403-51040425 AGCTGACCACATCCCAGTGAAGG + Intronic
1026242442 7:68588542-68588564 GGCTGAGGACAGACAAGTGAGGG - Intergenic
1027005416 7:74688802-74688824 GGCACTTTACAGCCCAGTGACGG - Intronic
1028289879 7:89051912-89051934 TCCTCAAAACAGCCCAGTGAGGG - Intronic
1032722447 7:134561603-134561625 GGCTTACGACAGCTCATAGAAGG - Intronic
1033594934 7:142852119-142852141 GCCTCAAGACAGTTCAGTGAAGG + Intergenic
1036850648 8:12198692-12198714 CCCTCATGACAGCCCAGTAAAGG + Intergenic
1036872013 8:12440957-12440979 CCCTCATGACAGCCCAGTAAAGG + Intergenic
1038659181 8:29482033-29482055 GGCTCAGAACAGGGCAGTGAAGG + Intergenic
1038699627 8:29837361-29837383 GGCTACGGACAGCCCAGTGCAGG + Intergenic
1047078433 8:121431868-121431890 TGCACACAACAGCCCAATGAGGG + Intergenic
1049740929 8:144240508-144240530 GGCTCCAGCCAGCCCTGTGAGGG + Intronic
1052223394 9:26054772-26054794 AGGTCAAGACAGCCCAGTGTAGG - Intergenic
1052946904 9:34175935-34175957 CTCTCAAGGCAGCCCAGTGAGGG - Intergenic
1052980279 9:34443412-34443434 GCCTCACCACAGCCCTGTCAAGG + Intronic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1055825743 9:80322211-80322233 TTCTCAGAACAGCCCAGTGAGGG - Intergenic
1057959197 9:99438469-99438491 GGCAAGAGACAGCCCAGTGAGGG - Intergenic
1059102659 9:111484497-111484519 GGCCCCCGACAGCCCAGTTCTGG + Exonic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185652938 X:1661808-1661830 GGCCCACCACAGCCCAGAGTTGG + Intergenic
1186786062 X:12956584-12956606 GCCTCCCAACAGCCCTGTGAGGG - Intergenic
1187400391 X:18954386-18954408 GGCTGACAGCAGCCCCGTGACGG + Exonic
1188727799 X:33607142-33607164 GGCTGAGGGCAGCTCAGTGAAGG - Intergenic
1193468778 X:81875592-81875614 GGCAAAGGACAGCTCAGTGATGG - Intergenic
1195026449 X:100882298-100882320 TGCTCACCACAGCCCTGTGATGG - Intergenic
1195349964 X:103986393-103986415 GGCTCCCGACAAGCCTGTGATGG - Intergenic
1195357479 X:104052446-104052468 GGCTCCCGACAAGCCTGTGATGG + Intergenic
1195364332 X:104112639-104112661 TGCGCACGACCGCCCAGCGAGGG - Exonic
1195777904 X:108427917-108427939 TGCTCAAGACAACCCTGTGAGGG - Intronic
1196750178 X:119108937-119108959 GGCTTACAACAGCCCTGTGGGGG + Intronic
1197679756 X:129369830-129369852 GTCTCACAAAAACCCAGTGAAGG + Intergenic
1199816852 X:151405023-151405045 GGCTCACGACAGTGGCGTGAAGG + Exonic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic