ID: 938011368

View in Genome Browser
Species Human (GRCh38)
Location 2:127831558-127831580
Sequence CATTTTCTGAGCCGTGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938011368_938011371 8 Left 938011368 2:127831558-127831580 CCAGCTACACGGCTCAGAAAATG No data
Right 938011371 2:127831589-127831611 GCTTCTGTGAATGCAGGCCTGGG No data
938011368_938011369 2 Left 938011368 2:127831558-127831580 CCAGCTACACGGCTCAGAAAATG No data
Right 938011369 2:127831583-127831605 TTAGAAGCTTCTGTGAATGCAGG No data
938011368_938011370 7 Left 938011368 2:127831558-127831580 CCAGCTACACGGCTCAGAAAATG No data
Right 938011370 2:127831588-127831610 AGCTTCTGTGAATGCAGGCCTGG No data
938011368_938011372 21 Left 938011368 2:127831558-127831580 CCAGCTACACGGCTCAGAAAATG No data
Right 938011372 2:127831602-127831624 CAGGCCTGGGTCCATCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938011368 Original CRISPR CATTTTCTGAGCCGTGTAGC TGG (reversed) Intergenic
No off target data available for this crispr