ID: 938011371

View in Genome Browser
Species Human (GRCh38)
Location 2:127831589-127831611
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938011366_938011371 17 Left 938011366 2:127831549-127831571 CCTGGAGGCCCAGCTACACGGCT No data
Right 938011371 2:127831589-127831611 GCTTCTGTGAATGCAGGCCTGGG No data
938011367_938011371 9 Left 938011367 2:127831557-127831579 CCCAGCTACACGGCTCAGAAAAT No data
Right 938011371 2:127831589-127831611 GCTTCTGTGAATGCAGGCCTGGG No data
938011368_938011371 8 Left 938011368 2:127831558-127831580 CCAGCTACACGGCTCAGAAAATG No data
Right 938011371 2:127831589-127831611 GCTTCTGTGAATGCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr