ID: 938015355

View in Genome Browser
Species Human (GRCh38)
Location 2:127862666-127862688
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938015355_938015359 -4 Left 938015355 2:127862666-127862688 CCATTGCTGGACTTGTGTGGGAG 0: 2
1: 0
2: 1
3: 18
4: 155
Right 938015359 2:127862685-127862707 GGAGCATGAGGGAATGTGCAGGG 0: 1
1: 0
2: 0
3: 42
4: 394
938015355_938015358 -5 Left 938015355 2:127862666-127862688 CCATTGCTGGACTTGTGTGGGAG 0: 2
1: 0
2: 1
3: 18
4: 155
Right 938015358 2:127862684-127862706 GGGAGCATGAGGGAATGTGCAGG 0: 1
1: 0
2: 2
3: 35
4: 359
938015355_938015360 3 Left 938015355 2:127862666-127862688 CCATTGCTGGACTTGTGTGGGAG 0: 2
1: 0
2: 1
3: 18
4: 155
Right 938015360 2:127862692-127862714 GAGGGAATGTGCAGGGAGTAAGG 0: 1
1: 0
2: 2
3: 32
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938015355 Original CRISPR CTCCCACACAAGTCCAGCAA TGG (reversed) Exonic
900374418 1:2346950-2346972 CACCCACACCAGTCCAGCCCTGG - Intronic
900836612 1:5009812-5009834 CTCCCTCACAAGTGCAACCAGGG - Intergenic
903656788 1:24954418-24954440 AGCCCACACAAGTCCAGGGAAGG + Intronic
905012101 1:34754838-34754860 CTCCCACACAAGCCCACAGATGG + Intronic
905090931 1:35430873-35430895 CTCCCACACAAATCCTCCAATGG - Intergenic
907689746 1:56651025-56651047 CTAGCACACAAGTCAAGCAAGGG - Intronic
908670242 1:66538699-66538721 GTCTCACACAAGTCCATCAAAGG + Intronic
915516676 1:156417198-156417220 CTCCCACCCAATTCCAGGCATGG - Intronic
916283928 1:163083287-163083309 CACACACACAAGTCCAGTAAAGG + Intergenic
917099471 1:171431069-171431091 CCCCTTCACAAGTCCTGCAAAGG - Intergenic
918781843 1:188709465-188709487 CTCCCACCCCAGACCAGGAATGG - Intergenic
923287264 1:232508445-232508467 CTGCCACACAGTTCCAGCACTGG + Intronic
923686071 1:236154626-236154648 ATACCAGACACGTCCAGCAAGGG + Intronic
1067557332 10:47282215-47282237 CTCCCCCACAAGTCCTTCACAGG + Intergenic
1069033953 10:63629278-63629300 CCCACACACAACTCCAGAAAAGG + Intergenic
1070744879 10:78927642-78927664 CTCCCACACAGCCCCAGGAAGGG + Intergenic
1070949344 10:80418551-80418573 CTCCCGGCCAAGTCCTGCAAGGG + Intronic
1073326749 10:102647668-102647690 CTCGCCCACAACACCAGCAAAGG - Intronic
1074491688 10:113944627-113944649 CTCCCACAAGAAACCAGCAAGGG + Intergenic
1080408078 11:31997696-31997718 CTCCCACACAATTCCTGGCAGGG + Intronic
1080679348 11:34459593-34459615 CACTCACGCAGGTCCAGCAAGGG + Intronic
1081683456 11:45025015-45025037 CTCACTCACAAGTCTAGCAATGG - Intergenic
1084792912 11:71486105-71486127 CTGCCCCTCAAGTCCAGCAGTGG + Intronic
1085947080 11:81284870-81284892 CCCCTTCACAAGTCCTGCAAAGG + Intergenic
1088959700 11:114650712-114650734 CTCCCACCCAAGACCAACCATGG + Intergenic
1090805500 11:130199684-130199706 CTCCCTCACAAATGCAGCGAGGG - Intronic
1093383228 12:18520752-18520774 CTGCAACACCTGTCCAGCAAGGG - Intronic
1093471821 12:19510342-19510364 CTCCCCCACAACTCCAATAATGG - Intronic
1098110179 12:67113355-67113377 CACACACACGAGTCCAGCATTGG - Intergenic
1098701371 12:73631986-73632008 CTACCACACAAATCAAGAAATGG + Intergenic
1099216664 12:79861763-79861785 CACCTACTCAAGCCCAGCAATGG - Intronic
1102491748 12:113293478-113293500 GTCCCACACAACCCCAGCAGTGG - Intronic
1102531054 12:113547067-113547089 CTCCCACAGAAAGCCAGCGACGG + Intergenic
1103921492 12:124401758-124401780 CTCCCAGACGCTTCCAGCAAGGG - Intronic
1104581180 12:130011924-130011946 CTACCACAAAATTCCAGCCAAGG - Intergenic
1106589395 13:31086513-31086535 CTCCCACCAAAGTCCAAGAAGGG - Intergenic
1107824356 13:44314159-44314181 CTCTAAAAGAAGTCCAGCAAAGG + Intergenic
1108860677 13:54854625-54854647 CACCATCACAAGACCAGCAAGGG - Intergenic
1109126088 13:58519093-58519115 GTCCCAAACAACTCCAACAAAGG - Intergenic
1112135977 13:96578129-96578151 CTCCCACACAAGTCCAGCAATGG + Intronic
1112685046 13:101815214-101815236 CTCCCACACCAGTCCAGTTATGG - Intronic
1113351189 13:109530787-109530809 ACCACTCACAAGTCCAGCAAAGG + Intergenic
1113692487 13:112321373-112321395 CCCCCAAGCAAGGCCAGCAATGG + Intergenic
1117226917 14:53670599-53670621 CACCCACACATGACCAACAATGG + Intergenic
1117373124 14:55096980-55097002 CTCCCCCACAAGTTCAGCTGTGG + Intergenic
1117450489 14:55845238-55845260 CCCCTTCACAAGTCCTGCAAAGG - Intergenic
1118949814 14:70425945-70425967 CTCTGACAAAAGGCCAGCAAAGG - Intergenic
1120263679 14:82221186-82221208 AACCCGCACATGTCCAGCAAGGG - Intergenic
1121606019 14:95240570-95240592 CTCACTCAACAGTCCAGCAAGGG - Intronic
1122120504 14:99550938-99550960 CTCCATCACCAATCCAGCAAAGG + Intronic
1122292817 14:100688591-100688613 CCCCCACCCAAGTCCTGCAGAGG - Intergenic
1125054465 15:35341405-35341427 CTGCAACACCACTCCAGCAAGGG - Intronic
1131385867 15:92006816-92006838 CTACCACTCCAGTCCAGAAAGGG + Intronic
1132324612 15:100958429-100958451 CTCCCCAGCAAGCCCAGCAAGGG + Intronic
1133871730 16:9695039-9695061 CACCCACACAAGTTCAGCTCAGG + Intergenic
1133917421 16:10121603-10121625 CTCCAACACAAGCAAAGCAAAGG + Intronic
1134047222 16:11109674-11109696 CTCCCTCACACGTGCAGCCACGG + Intronic
1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG + Intronic
1137268039 16:46884613-46884635 CCCCCACACAAGCCCAGCCAAGG - Intronic
1139494369 16:67305598-67305620 CTCCCTCAAAAGTCCTGCAGGGG + Intronic
1144217699 17:13070988-13071010 CTTCCACGCAGGTCCAGAAATGG + Intergenic
1148209292 17:45798650-45798672 CTCCCACCCCAGGGCAGCAAGGG - Intronic
1148332401 17:46820301-46820323 CACCCCCTCCAGTCCAGCAATGG - Intronic
1148586293 17:48783296-48783318 CTCCCACTGAAGCCCACCAAGGG - Intronic
1151517266 17:74604664-74604686 CTCCTACCCAAAGCCAGCAAAGG + Intergenic
1152433672 17:80262727-80262749 CTCCCACACAGGTCAAGCCAGGG + Intronic
1152433956 17:80263979-80264001 CTCCCACACAGGTCAAGCCAGGG + Intronic
1152882267 17:82825043-82825065 CTCCGACACAATTCCTCCAAAGG - Intronic
1154340414 18:13498109-13498131 TGCCCACACAAGTCCTGCCATGG + Intronic
1154380806 18:13848419-13848441 CTCCCACCCAGCACCAGCAAGGG + Intergenic
1156733147 18:40220694-40220716 CTCACAGACAAATCAAGCAAGGG + Intergenic
1157024945 18:43831322-43831344 CTCCCAGACAACTCCAGGAATGG - Intergenic
1160134572 18:76261603-76261625 CTCCCACACAGGCTCAGCAGAGG - Intergenic
1163152844 19:15425122-15425144 CTCCCACACAGACCCAGCCATGG + Intronic
1163265722 19:16219951-16219973 CTCCAACAAAATACCAGCAAAGG - Intronic
1164247144 19:23440984-23441006 GTACCACACAGGTCCAGCAGAGG - Intergenic
1164901790 19:31933447-31933469 CACACACACATCTCCAGCAAAGG + Intergenic
1165191495 19:34067490-34067512 CTCCCACAGAAGCCCTGCAATGG + Intergenic
1165781015 19:38434343-38434365 CTCCCCCACAAGACCCTCAAGGG - Intronic
1166569100 19:43782466-43782488 CACCCACACAACACCAGCATCGG + Intergenic
1166872281 19:45877961-45877983 CACCAACACAAACCCAGCAATGG - Intergenic
1167243685 19:48360725-48360747 CACACACACAATTCCAGGAACGG + Intronic
925697757 2:6599219-6599241 CACCCACACAGATGCAGCAATGG - Intergenic
925841115 2:7993428-7993450 CTCCATCACAAGGCCAGGAAGGG - Intergenic
925935350 2:8752418-8752440 TTCCCACCCAAGTCCTGCCATGG - Intronic
925965280 2:9059954-9059976 CTCCCAGGCAGGTACAGCAATGG + Intergenic
930162424 2:48171675-48171697 CACACACACAAGTCTAGAAAGGG - Intergenic
931401134 2:61932679-61932701 CCCTGTCACAAGTCCAGCAAGGG - Intronic
932366465 2:71156395-71156417 CTCCCACCCAAGTCCACCTCAGG - Intergenic
933200005 2:79437478-79437500 CTCTCACTCCAGTCCAGCAGTGG + Intronic
934761393 2:96858868-96858890 CTTCCTTACAAGTCCAGCAAGGG + Intergenic
934791701 2:97067732-97067754 CCCCATCACAAGTCCTGCAAGGG - Intergenic
935176683 2:100655016-100655038 TGCCCACAGAAATCCAGCAAAGG + Intergenic
938015355 2:127862666-127862688 CTCCCACACAAGTCCAGCAATGG - Exonic
938299940 2:130203253-130203275 CTCCCAGACAAGTCATGCAGGGG - Intergenic
938456771 2:131471236-131471258 CTCCCAGACAAGTCATGCAGGGG + Intronic
938947225 2:136224345-136224367 CTCCCAGAAAAGTCCATCAAAGG - Intergenic
941307981 2:163894006-163894028 CTTCCACACAAGTCAAGGACTGG + Intergenic
941725796 2:168858775-168858797 CTCCCCCACACCTCCAGCATGGG - Intronic
943546358 2:189284531-189284553 CTCCATCACAAGAACAGCAAGGG + Intergenic
946032628 2:216717301-216717323 CCCCCAGACAAGTGCAGGAAAGG - Intergenic
946854773 2:223941657-223941679 CTCCCCCACAGGTCTAGCATGGG + Intronic
946931002 2:224671109-224671131 CTTTCACACAACTCTAGCAATGG - Intergenic
948891024 2:240907165-240907187 CTCCCACAAATGTGCAGCGATGG - Intergenic
1168821241 20:775068-775090 CTCCCTCCCAAGGCCAGGAAGGG + Intergenic
1169255246 20:4091933-4091955 CACCCACCCAAGTCCAGAATCGG + Intergenic
1169272452 20:4211114-4211136 CTGCGACTCAGGTCCAGCAAAGG + Intergenic
1170070106 20:12357554-12357576 CTCCCACTCCAGACCTGCAATGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1176943275 21:14949793-14949815 CTCACTCATATGTCCAGCAATGG + Intergenic
1178936433 21:36866533-36866555 CTCCCACTCCAGTCTAGGAAAGG + Intronic
1185314112 22:50171385-50171407 CTTCCACCCAAGTCCAGCCTGGG - Intronic
1185371953 22:50465040-50465062 CTCTGACACAAAGCCAGCAAAGG + Exonic
949432222 3:3989928-3989950 CTCCCAAACAAGTCTAAAAATGG + Intronic
949693268 3:6664852-6664874 TCCCCACACAAGTCCAGCACAGG - Intergenic
953512287 3:43554581-43554603 CTCTGACACCATTCCAGCAAGGG + Intronic
955247811 3:57244441-57244463 CCACCACACATGGCCAGCAAAGG + Intronic
964247511 3:154670309-154670331 CCCCATCACAAGTCCCGCAAAGG + Intergenic
965326134 3:167307037-167307059 CACCCACACAGGTGCAGAAAAGG + Intronic
966918148 3:184596070-184596092 CTCCCACAAAGGTCCATCACAGG + Intronic
967547799 3:190752218-190752240 CTCCCACACATGTGCAGCCTTGG + Intergenic
969869005 4:10093327-10093349 ACCCCACACAAGCCCAGCACGGG + Intronic
969897863 4:10322018-10322040 CTCCCCCACAAGAGTAGCAAAGG + Intergenic
972688459 4:41373445-41373467 CTCCCAGACAAGGCCAGCCATGG - Intronic
972902814 4:43705708-43705730 CTCCATCACAAGAACAGCAATGG - Intergenic
975544365 4:75546392-75546414 CTCCCACACATCTCCAGTCAAGG + Intronic
979610485 4:122683953-122683975 CTCTCTCACAAGAACAGCAAGGG - Intergenic
980234892 4:130091793-130091815 CTCACACACAAGGCCATAAAAGG - Intergenic
983599543 4:169510637-169510659 ATCCCACACAAATCCTTCAATGG + Intronic
984217003 4:176926136-176926158 CTCCCAGTCAGGTCCAACAATGG - Intergenic
985039429 4:185874756-185874778 CACTCACACAATTCCAGCCAAGG - Intronic
985706838 5:1406337-1406359 CCCCCACACGTGTCCAGCATCGG - Intronic
987524651 5:19031505-19031527 CTCAAACACAACTCCAGTAAAGG + Intergenic
989254562 5:39352177-39352199 CTCCATCACAAGAACAGCAAGGG + Intronic
994914489 5:105956591-105956613 CACCCACACAAGCATAGCAAAGG - Intergenic
999206513 5:149852093-149852115 TTCCAACAAAAGGCCAGCAAAGG - Exonic
1002416346 5:179122806-179122828 CTCCCACACAGGGCCCGCACTGG + Intronic
1003103539 6:3195836-3195858 CGCCAACACAAGAACAGCAAGGG + Intergenic
1006620764 6:35362460-35362482 CTTCCATACAAATCCAGAAAAGG + Intronic
1010136310 6:72557812-72557834 CTGCCAAAGAAGTCAAGCAAAGG + Intergenic
1011259342 6:85455367-85455389 CACCCACCAAAGTCCAGGAAAGG + Intronic
1014880790 6:126721994-126722016 CTCCCAAACAAGTTCAGGATAGG - Intergenic
1016178455 6:141110797-141110819 CTTGCACACAAGGTCAGCAATGG - Intergenic
1024366767 7:48529084-48529106 CTACCACACAGGTGCAGAAAGGG - Intronic
1024572075 7:50731738-50731760 CTCCCACAAAATTCCACCTAGGG + Intronic
1026429270 7:70327390-70327412 CTCCCACAAAACTCATGCAAAGG - Intronic
1028653887 7:93180510-93180532 CTCCCAGACAACTTCAGCAAGGG - Intergenic
1029623875 7:101707473-101707495 CTCCCACACAGGGGCAGGAAAGG - Intergenic
1029647213 7:101865196-101865218 CTCCCACAGAAGTTCCACAAGGG - Intronic
1030557148 7:111040474-111040496 CTGCCAAACAATTACAGCAAAGG + Intronic
1030659377 7:112204419-112204441 GTCCCTCACCAGTCCAGCAAAGG + Intronic
1034564969 7:151905991-151906013 CTCCCACAAGTGTCCAGCCAGGG - Intergenic
1036671586 8:10792027-10792049 CTCCCGCTCAGGACCAGCAAGGG + Intronic
1039310504 8:36313491-36313513 CTCCATCACAAGAGCAGCAAGGG + Intergenic
1041773267 8:61495924-61495946 CTCCCACACCTGCCCAGCCAAGG - Intronic
1042037953 8:64557646-64557668 CTCAAACACAAGGCCAGAAAAGG + Intergenic
1042725744 8:71874749-71874771 CTCCATCACAAGAACAGCAAGGG - Intronic
1043213401 8:77552914-77552936 CTCCCAGACCAGTGTAGCAAAGG - Intergenic
1045698650 8:104840345-104840367 TTTCCACACAAGACAAGCAATGG - Intronic
1048048997 8:130799614-130799636 CTCCCAGGCATTTCCAGCAAGGG - Intronic
1050829187 9:9989948-9989970 CCCCTTCACAAGTCCCGCAAAGG + Intronic
1052122054 9:24730407-24730429 CTCCATCACAAGTCCAACGAAGG - Intergenic
1056271775 9:84954367-84954389 CTAACACGCAAGTCCTGCAAGGG - Intronic
1056532084 9:87497264-87497286 CTCCAACACCAGTCCGGCAGAGG + Intronic
1061466709 9:130786147-130786169 TTCCCACAGAAGCCCAACAAAGG - Intronic
1062155794 9:135047358-135047380 CTCCCCCACAAGGCCAGCCAGGG - Intergenic
1062732140 9:138115966-138115988 CTGCCACAGAAACCCAGCAAAGG - Intronic
1186554458 X:10543131-10543153 CAGCCACACAAGTACAGCACTGG + Intronic
1187217133 X:17288096-17288118 CTCACACATATGTCCAGCATTGG - Intergenic
1191733020 X:64357735-64357757 GTCACACTCAAGTCCTGCAATGG + Intronic
1192149277 X:68701908-68701930 CTCCCACCCAATTCTAGCATGGG - Intronic
1192292954 X:69816299-69816321 CTCCAACACCTCTCCAGCAAAGG + Intronic
1193176586 X:78401393-78401415 CTGCAACACCTGTCCAGCAATGG + Intergenic
1193350314 X:80456199-80456221 CTCCCACAAAAATCCAGCAATGG - Intergenic
1198763497 X:140058245-140058267 CTCCCCCACAAGCCCATCACTGG - Intergenic
1200089401 X:153627269-153627291 GTCCCACACAAGCCTAGAAATGG + Intergenic