ID: 938015856

View in Genome Browser
Species Human (GRCh38)
Location 2:127866680-127866702
Sequence CTGGGGGCACAGTTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938015856_938015866 7 Left 938015856 2:127866680-127866702 CCCTGCTCCAACTGTGCCCCCAG 0: 1
1: 0
2: 1
3: 25
4: 317
Right 938015866 2:127866710-127866732 ATGGAGACACACAGGATGCTGGG 0: 1
1: 0
2: 3
3: 16
4: 253
938015856_938015864 -1 Left 938015856 2:127866680-127866702 CCCTGCTCCAACTGTGCCCCCAG 0: 1
1: 0
2: 1
3: 25
4: 317
Right 938015864 2:127866702-127866724 GCTCAGCTATGGAGACACACAGG 0: 1
1: 0
2: 1
3: 50
4: 696
938015856_938015865 6 Left 938015856 2:127866680-127866702 CCCTGCTCCAACTGTGCCCCCAG 0: 1
1: 0
2: 1
3: 25
4: 317
Right 938015865 2:127866709-127866731 TATGGAGACACACAGGATGCTGG 0: 1
1: 0
2: 1
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938015856 Original CRISPR CTGGGGGCACAGTTGGAGCA GGG (reversed) Intronic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900700584 1:4046414-4046436 TTGGGGGCAGAGTGAGAGCAAGG + Intergenic
901212554 1:7534726-7534748 CAGGGGGCAGAGTTGGGGCCTGG + Intronic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
903361469 1:22779872-22779894 CTGGGCACAGAATTGGAGCATGG + Intronic
903489589 1:23718189-23718211 TTGGGTGCATAGTTTGAGCATGG + Intergenic
904046921 1:27614731-27614753 CTGGAGGCACAGCTGATGCAGGG + Intronic
904619438 1:31766497-31766519 CCGGGGGCTCAGTAGGGGCAAGG + Intergenic
905847176 1:41242389-41242411 CCGGGGGCCCAGTTGGCGCCCGG + Intergenic
906107515 1:43303828-43303850 TGGGAGGTACAGTTGGAGCAGGG - Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
908758432 1:67490349-67490371 ATGTGGGCACAGTTGGAGATAGG - Intergenic
909668870 1:78165852-78165874 CAGGGGTCACGGTAGGAGCATGG - Intergenic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912779560 1:112532501-112532523 CTTAGGGGACAGTTGGAGAAGGG - Intronic
914449044 1:147774421-147774443 CTGGGGGAGAAGTTGGAGAATGG - Intergenic
914921019 1:151847579-151847601 CTAGGGACACAGATGAAGCAAGG - Intronic
915477466 1:156161323-156161345 CTGGGGGCACAGGGGGAGTCAGG - Intronic
915577715 1:156791642-156791664 CTGAGGGCACAGTTGGAGAGGGG - Intronic
915586410 1:156846102-156846124 CTTGGGGCACCGTGGGAGCTAGG + Exonic
919802882 1:201364233-201364255 CTGGGGGCCCAGCAGGAGCTGGG + Intronic
919838991 1:201595590-201595612 CTGGGGGCATAGTGGGGCCAGGG + Intergenic
919854734 1:201697443-201697465 CTGGGGGCAAGGTATGAGCAAGG - Intronic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
922892296 1:229071432-229071454 CGGGGAGCAGAGTTGGAGCCTGG + Intergenic
923629287 1:235639373-235639395 CTGGGGGCTCTGTTTCAGCAAGG - Intronic
924894190 1:248317856-248317878 ATGAGGGCACAGTGGGAGTACGG + Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1067080807 10:43211293-43211315 CTGGGGGCACCATTCGAGAAGGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1070742478 10:78912082-78912104 CTGGTGGCTCCTTTGGAGCAAGG + Intergenic
1070833558 10:79434500-79434522 CTGGGGTCACAGTAAGAGCTTGG - Intronic
1071495476 10:86164855-86164877 CTGGGGGCACATCAGCAGCATGG + Intronic
1075117475 10:119638939-119638961 CTGGGGGAGCAGTTCCAGCAGGG + Intergenic
1075260328 10:120958033-120958055 CTGGGGGAGCAGTTGGTACAGGG + Intergenic
1075728857 10:124624588-124624610 CTGGGAGCACACTTGGTGCCTGG - Intronic
1076870348 10:133189832-133189854 CTGGGGGCAGGGCTGGGGCAGGG - Intronic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077533630 11:3108538-3108560 CTGTGGGCAGCGGTGGAGCAGGG + Intronic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079420573 11:20283421-20283443 CAGGAGGCAAAGTTGGACCAGGG + Intergenic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1083288437 11:61676033-61676055 CTGGGAGCTGAGTTGGGGCAGGG + Intergenic
1084093590 11:66895237-66895259 CTGGGAGCTCAGTTGGGGAAGGG - Intronic
1084676905 11:70640640-70640662 CTGGGGGCCCACTACGAGCAGGG + Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088821192 11:113458893-113458915 CTGGGGGCAGCGATGGGGCAGGG + Intronic
1089073919 11:115721770-115721792 CTGGGGGCACTGTGCCAGCATGG + Intergenic
1089677496 11:120099566-120099588 GTGGGCACACGGTTGGAGCAGGG + Intergenic
1090889868 11:130914439-130914461 CTGGTGGCAGAGTAGGATCAAGG + Exonic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091291261 11:134441155-134441177 CTGAGGTCACAGTTGGAAAAGGG + Intergenic
1091370607 11:135055036-135055058 CTGGGAGCTCAGGTGGAGAATGG - Intergenic
1091450446 12:569411-569433 CAGGGGGCACAGTTGAACCTGGG - Intronic
1092117381 12:6019004-6019026 CGGGGGGCAGAGTAGGAGGAGGG + Exonic
1092232370 12:6783268-6783290 CTGGGGGCAGGGTTTGAGGATGG - Intergenic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1098066620 12:66625136-66625158 CTGGGGACAGATTTGGAGAAAGG + Intronic
1098289630 12:68945499-68945521 CAGGGGGTATAGTTGGGGCAAGG + Intronic
1099145029 12:79032092-79032114 CTGGTGGTACAGTTGAATCATGG - Intronic
1099394551 12:82121445-82121467 CTGGTGGCAGTGTTGGTGCAGGG - Intergenic
1101432103 12:104635156-104635178 CTGGGGTCACCTTTGGAGCTTGG - Intronic
1101616408 12:106342273-106342295 CTGGGGGCAAAGTTGAAGCTTGG - Intronic
1101800680 12:108019358-108019380 CTGGGGGCACACGTGCAGTAAGG - Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102474084 12:113177380-113177402 CTGGGGGCACTGTGGGTGGAAGG - Intronic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103786298 12:123435898-123435920 CTGGGGGATCACTTGGAGCCAGG + Intronic
1104298202 12:127538295-127538317 CTGGGTGCACAGTAAGAGAACGG + Intergenic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113437315 13:110303337-110303359 CTGGGGCCTCAGTTGGAGCTGGG + Intronic
1113788212 13:113014095-113014117 CTGGGAGCACGGGGGGAGCATGG - Intronic
1114728060 14:24960165-24960187 CTGGGGGCAGATTGAGAGCAAGG + Intronic
1117388801 14:55243515-55243537 CAGGGGGCACATTTGAAGGAAGG - Intergenic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1119062679 14:71492184-71492206 CTGATGGCACAGTTACAGCAAGG + Intronic
1119473312 14:74912427-74912449 CTGGAGGTCCAGTTGGAACAGGG - Intronic
1122869838 14:104633305-104633327 CTGGGAGCACCCATGGAGCACGG + Intergenic
1123014376 14:105366786-105366808 GTGGAGGCAGGGTTGGAGCAGGG + Intronic
1123130107 14:105978641-105978663 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1202902374 14_GL000194v1_random:51160-51182 GTGGGAGCACAGTTGGCACAGGG + Intergenic
1123580360 15:21709767-21709789 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1123617008 15:22152390-22152412 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1124685167 15:31776399-31776421 CTGTGGGGAGAGTGGGAGCAAGG + Intronic
1126408745 15:48350004-48350026 CGGGGGGAAGAGTGGGAGCAGGG + Intergenic
1126979701 15:54227634-54227656 CTGGGGCCACTTTTGGAACAAGG - Intronic
1128110287 15:65071818-65071840 CTGGGGGCAGGGCTGGAGAAGGG - Intronic
1128223389 15:65984080-65984102 CTTGGGGCACAGATGAAGAAGGG - Intronic
1128382906 15:67126527-67126549 CTGAGGGGGAAGTTGGAGCAGGG - Intronic
1128592535 15:68913620-68913642 CTTGGGGTACAGTTTCAGCAGGG - Intronic
1128861980 15:71081833-71081855 CTAGTGGCACAGGAGGAGCATGG + Intergenic
1129243986 15:74268815-74268837 CTGTGGGCTCAGGGGGAGCACGG - Intronic
1131274679 15:90971134-90971156 CTGGGGGCAAACTAGGAGCCAGG + Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1202989230 15_KI270727v1_random:444012-444034 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1132640394 16:975664-975686 CGAGGGGCAAAGTGGGAGCAGGG - Intronic
1132669989 16:1098564-1098586 GTGGGAGCACAGTGGGCGCAGGG + Intergenic
1132686237 16:1163294-1163316 AGTGGGGCCCAGTTGGAGCAGGG + Intronic
1132897474 16:2235942-2235964 CTGGGGGCACAGCTCCAGCTGGG - Exonic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133416791 16:5613126-5613148 GAGGGGCCTCAGTTGGAGCAGGG + Intergenic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1134102504 16:11461966-11461988 CTGGGGGCTCACATGGAGCTTGG + Intronic
1135954076 16:26940998-26941020 CGAGGGGCACAGCTGGAGGAGGG + Intergenic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1137821358 16:51449025-51449047 CTGGGACCTGAGTTGGAGCATGG - Intergenic
1138258254 16:55589545-55589567 CTGGGTGCTTGGTTGGAGCAGGG + Intergenic
1140457765 16:75114776-75114798 CTGAGGGCACCGTGGGAGCAGGG - Intronic
1140707647 16:77645498-77645520 CTGGGGACTCAGTTGTTGCATGG + Intergenic
1141440540 16:84026867-84026889 CTGCGGGCAGAGGTGGAGAATGG + Intronic
1141702379 16:85648443-85648465 CTGGGGCCTCACTTGGAGCAGGG + Intronic
1142126585 16:88413613-88413635 CTGGGGGCAGCGTTATAGCAAGG + Intergenic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144366 16:88486710-88486732 CTGGGGGCACAGTGGATGCTGGG + Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1144702697 17:17349292-17349314 CTGGGGGCTGACTTGGTGCAGGG + Intergenic
1144874796 17:18391836-18391858 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1145157429 17:20552585-20552607 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145799841 17:27675932-27675954 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146159363 17:30551666-30551688 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1146845216 17:36178148-36178170 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146873432 17:36389991-36390013 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146880791 17:36441079-36441101 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146932186 17:36785217-36785239 CTAGGGGCCCTGTGGGAGCAGGG - Intergenic
1147065958 17:37922882-37922904 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1147425555 17:40344403-40344425 CTAGGGGGATAGTTGGAGCAGGG + Intronic
1147479466 17:40745446-40745468 CTGGGGACCAAGTTGGTGCAAGG + Intergenic
1147538138 17:41334188-41334210 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148909003 17:50930138-50930160 CTGGGGGCAGCTTTGCAGCATGG - Intergenic
1148961563 17:51397567-51397589 TTGGGGCCAGAGTTGGAGCCAGG + Intergenic
1149291870 17:55225421-55225443 CAGAGGGCACAGGAGGAGCAGGG - Intergenic
1149664722 17:58357747-58357769 CTGGGTGCACAGTTGCATCCTGG + Exonic
1150556905 17:66262703-66262725 CTGGGGGCAGGGATGGAGAAGGG + Intergenic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1151720827 17:75855086-75855108 CTGGGGGCGGGGTTGGAGGAAGG - Intronic
1152131662 17:78480839-78480861 TTGGGAGCACAGTGGGGGCAGGG - Intronic
1153243738 18:3053874-3053896 CTGGGTGCTTAGTTGGAGAATGG - Intergenic
1154200893 18:12299899-12299921 CTAAGGGCACTGTTGGAGAAGGG - Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1157444023 18:47731455-47731477 CTGGGGGTACTGTTGGAGGCTGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160191875 18:76721497-76721519 CATGGGGCACAGTAGGGGCAGGG + Intergenic
1160406134 18:78647433-78647455 CGGGGACCACAGATGGAGCAGGG - Intergenic
1160534650 18:79585601-79585623 GCGGGGACACAGTGGGAGCATGG - Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160542850 18:79634590-79634612 TTGGGGGCACAGTGGGGGCGAGG - Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160974264 19:1784981-1785003 CTGGGGGCATCCTTGGAGCTGGG - Intronic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1161637027 19:5395356-5395378 CTGGGGGCTCCGGTGGAGCCCGG + Intergenic
1161687817 19:5712071-5712093 CTGGTGGCACAGGTGGTCCAAGG + Intronic
1161814583 19:6492014-6492036 CTGGGGGCTCAGCAGGAGTAAGG - Intergenic
1162403166 19:10458107-10458129 GTGGGGGCTCAGTAGGGGCAGGG + Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162758587 19:12874798-12874820 CTGGGGGCACAGCTTCAGCAGGG - Exonic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1163440871 19:17322052-17322074 CAGGGGCCAGAGTGGGAGCAGGG + Exonic
1164044656 19:21526324-21526346 TTGGGGGAAGAGTGGGAGCAGGG - Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1166827909 19:45620983-45621005 GAGGCAGCACAGTTGGAGCAGGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
925025739 2:605938-605960 CTGGGGGCTCACCTGCAGCATGG - Intergenic
926489771 2:13510788-13510810 CTGAGAGTACAGTTGAAGCAAGG + Intergenic
927138673 2:20115134-20115156 CTGGGTGCACGGTTGGCCCAGGG + Intergenic
927195407 2:20543045-20543067 CTGGGGGCATAGATGAAGCGGGG + Intergenic
927523447 2:23716837-23716859 GTGAGGGCACAGTTGGAGGTGGG - Intergenic
928051003 2:27995286-27995308 CTGGCAGCACCGTGGGAGCAAGG + Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
932044040 2:68329207-68329229 TTGGGGGCCAAGTTGGAGCCTGG + Intergenic
932667377 2:73708301-73708323 CAGGGGGCACATGTGGAGCCTGG - Intergenic
933050155 2:77592356-77592378 CTGGGTGCAAAGTTGCAGGATGG + Intronic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
933674187 2:85039013-85039035 CTGGGGCCAAAATTGGGGCAGGG - Intronic
934504297 2:94879244-94879266 GTGGGAGCACAGTGGGCGCAGGG - Intergenic
936021873 2:109001350-109001372 GTGGGGTCACAGTAGGGGCAGGG + Intergenic
936080506 2:109429633-109429655 CCTGGGGCACAGCTGGGGCAGGG - Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938081989 2:128374957-128374979 GTGGAGGCACAGGTGGTGCAGGG + Intergenic
939008860 2:136821505-136821527 CTGGTGGCTGAGTTGGAACAGGG + Intronic
940644656 2:156378107-156378129 CAGGGGGGACTATTGGAGCAGGG - Intergenic
942428902 2:175888622-175888644 CTGGGGGGAAATTTGGAGAAGGG + Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
943388701 2:187234180-187234202 TTGGGGGAAGAGTTGGGGCAAGG - Intergenic
945922149 2:215765983-215766005 CTGAGGGCCCAGTGGGAGCTAGG + Intergenic
946300822 2:218823030-218823052 CTGGGAGCACAGGTAGGGCAAGG + Exonic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948565349 2:238882900-238882922 CAGGGGGCACACCTGGACCACGG - Intronic
948571445 2:238920295-238920317 CTGAGGCCACTGTGGGAGCATGG - Intergenic
1169206403 20:3742540-3742562 CTGGGGTAAAAGTTGGAGGATGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1171249798 20:23638531-23638553 GTGGGGGCGAAGTGGGAGCAAGG - Intergenic
1172009504 20:31838151-31838173 CTGAGGGCACACAAGGAGCAGGG + Intergenic
1172883547 20:38217050-38217072 CTGGGGGCACAGCAGGGACAGGG - Intronic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1175857926 20:62132766-62132788 CTGGGTGCACAGTTGGATGTGGG + Intronic
1176621742 21:9065927-9065949 GTGGGAGCACAGTTGGCACAGGG + Intergenic
1177462329 21:21429286-21429308 CAGGGTGCACAGTTGGTGAATGG + Intronic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179838436 21:44053744-44053766 CTGGAGGCACATGTGGAACAAGG - Intronic
1180230596 21:46424699-46424721 GGGGGGGCGCAGTGGGAGCAGGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1181830378 22:25555715-25555737 TTGGGGCCAGTGTTGGAGCATGG - Intergenic
1181837473 22:25622684-25622706 CTGGGATCAGAGTGGGAGCATGG + Intronic
1182410003 22:30176702-30176724 CTGGGGCCAGAGTTGAGGCAGGG - Exonic
1182512633 22:30829920-30829942 CGGGGGCCAAAGTGGGAGCAGGG + Intronic
1182605157 22:31497050-31497072 CTGCGGGCTCAGTGGGAGTAAGG - Intronic
1183604284 22:38859681-38859703 AAGGGGGCACAATTGGAGCAGGG - Intergenic
1184033714 22:41909051-41909073 ATGGGGGAAAAGCTGGAGCAGGG - Intergenic
1184798074 22:46743247-46743269 ATGGGGCCACATTTGGAGCCTGG + Intergenic
1185387768 22:50544194-50544216 CTGTGGCCGCAGTTGGAGGATGG - Intergenic
1185404070 22:50635880-50635902 CGGGGGGCACAGCTGGGCCAGGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949425906 3:3915591-3915613 CTGGGGGCTCAGCTGGTCCAAGG + Intronic
950669873 3:14519601-14519623 CAGAGGGCACAGTTGGGGCCAGG - Intronic
952859948 3:37804629-37804651 CTGGGGACACAGTGGAAACAAGG - Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
954301699 3:49703840-49703862 CTGAGGGCACAGCGAGAGCAAGG + Intronic
955228517 3:57079582-57079604 CTGGCGGGACAGTGGGAGCGAGG - Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
962412351 3:135152381-135152403 CTGGGGGTACAGCAGGAGCTTGG + Intronic
962422025 3:135237519-135237541 CAGGGGTCACTGTTGGAGCATGG - Intronic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
965953890 3:174344646-174344668 CTGAGGTCTCAGTTGGAGCATGG + Intergenic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966924107 3:184633467-184633489 CTGGGGGCAGAGTCGGGGAAGGG - Intronic
967864061 3:194175816-194175838 CTGGGGGCTCCCTGGGAGCACGG + Intergenic
968520393 4:1032400-1032422 CTGGGGGCACAGTGGCTGCTGGG + Intergenic
968599584 4:1502669-1502691 CTCGGGGCACAGGCGGTGCATGG - Intergenic
968612510 4:1563641-1563663 GTGGGGGCACTGGAGGAGCAAGG + Intergenic
968683664 4:1940664-1940686 CTGGGGGCCCTTTTGGAACAGGG + Intronic
969564931 4:7971897-7971919 CTGGGGGCCCAGGCTGAGCAGGG - Intronic
971344744 4:25801744-25801766 CTGGGAGCACTGGTGTAGCAAGG + Intronic
973027661 4:45293166-45293188 CTGTGGGCAGTGTTGGTGCAAGG + Intergenic
974100609 4:57411899-57411921 CAGAGGGCAAAGTAGGAGCAAGG - Intergenic
976148180 4:82064702-82064724 CTGGTTGCCCAGTTGGAGTAGGG - Intergenic
976587117 4:86811372-86811394 CTGGGGACAGAGTTTGAGAATGG + Intronic
980308040 4:131090309-131090331 TTGGGGGCAAGGTTGGAGTAAGG - Intergenic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
986124575 5:4873404-4873426 CCTGGGGCATAGTTAGAGCAAGG - Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
992472753 5:77074751-77074773 ATGGTGGTACAGTGGGAGCATGG + Exonic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
997376831 5:133403472-133403494 CTGGGGCCACACGAGGAGCAAGG - Intronic
997406561 5:133653473-133653495 CAGGGGCCTGAGTTGGAGCAGGG - Intergenic
997569566 5:134915816-134915838 CTGAGGGCAGGGTTGCAGCAAGG - Intronic
997891616 5:137682036-137682058 CTGGGGGTACAGTTGGGTCTCGG + Intronic
998191658 5:140030477-140030499 CTGTGGGCATAGGTGAAGCAGGG + Intronic
998790610 5:145762923-145762945 CTGGGGCCACACTTTGAGAATGG - Intronic
1000015716 5:157273691-157273713 CTGGGGGTAGAGTAGGAGCTTGG - Intronic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1001480562 5:172086464-172086486 CTGAGAGCACAGGTGGACCAGGG - Intronic
1002565767 5:180112432-180112454 CTGGGGGTAGAGGTGCAGCATGG - Intronic
1006417674 6:33914284-33914306 ATGGGGGCAGATTTGGAGAATGG - Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1010454096 6:76035132-76035154 CTAGGGGCACTGAAGGAGCAGGG + Intronic
1011632479 6:89340475-89340497 CTGGCAGTAGAGTTGGAGCAGGG - Intronic
1012882903 6:104813058-104813080 CTGGGAGCCTAGTTGGAACATGG - Intronic
1014741785 6:125154670-125154692 TTGGGGTCACACTTGGAACAGGG + Intronic
1015636973 6:135286595-135286617 CTGGGGGCACAGGAGGTGTAGGG + Intronic
1016920673 6:149289899-149289921 TGGGGGGCACAGTGGCAGCAGGG + Intronic
1019272207 7:156638-156660 CAGAGGGTACAGATGGAGCAGGG - Intergenic
1022335217 7:29415572-29415594 CTCGGGACACAGTTGGTGGAGGG + Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023674620 7:42616855-42616877 GTGGGGCCACAGGTGAAGCAGGG + Intergenic
1023765050 7:43502864-43502886 CTAGGGCCAGGGTTGGAGCATGG + Intronic
1025712743 7:63927317-63927339 CTGGCGGCACTGGGGGAGCAGGG - Intergenic
1027400163 7:77798689-77798711 CTGTGGGCCCAATGGGAGCACGG - Intergenic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1031007827 7:116494817-116494839 GTGGGGGGACAGTTGGAGGTGGG + Intronic
1035734250 8:1876311-1876333 CTCGGGGTACAGATGGGGCAGGG + Intronic
1036766624 8:11553648-11553670 CTGGGGGCACAGCTGCACCCGGG + Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039475130 8:37835616-37835638 CTGGGGGCACCGGGGGAGCCAGG - Exonic
1039899276 8:41739880-41739902 CTGGGAGAAGAGTAGGAGCATGG - Intronic
1041106896 8:54453549-54453571 CCGGGGCCACAGTTGGAGGTGGG + Intergenic
1041257404 8:55991127-55991149 CTGGTGGCAGAGTGGGATCAGGG - Intronic
1041414961 8:57597812-57597834 CTGGGGGCACTGTGGGAGCCAGG - Intergenic
1041880571 8:62745331-62745353 CAGGGGGCCATGTTGGAGCAGGG - Intronic
1042645552 8:70982492-70982514 CTGGGGGCTGTGTGGGAGCAGGG - Intergenic
1045349252 8:101323101-101323123 CTTGGGGCACACTTTGACCAAGG + Intergenic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048529616 8:135235477-135235499 ATGGGGGCACAGTTGGTACAGGG - Intergenic
1048996030 8:139794197-139794219 CTGGGACCACAGTGGGAGCCAGG - Intronic
1049030756 8:140035801-140035823 CTGTGGGCTCACGTGGAGCAAGG - Intronic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1049228732 8:141470952-141470974 CTGGGGGTAAATTTGGGGCAAGG + Intergenic
1049302692 8:141879972-141879994 CTGGGAGCACAGGTGGAGAGGGG - Intergenic
1049338868 8:142101236-142101258 CTGGGTGCACACTTGGAGCCAGG + Intergenic
1052597012 9:30574537-30574559 CTGGGAGCATGGTGGGAGCATGG - Intergenic
1052824193 9:33163505-33163527 CTGGGGGCTCAGCTGGGGCCTGG - Intronic
1056551983 9:87659849-87659871 CCGGGGGCACAGTGAGAGCGGGG + Intronic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1059432524 9:114258633-114258655 GAGGGGGCACACTTGGAACAGGG + Intronic
1059841506 9:118222632-118222654 CTGAGGGCATAGTGGCAGCATGG + Intergenic
1060045533 9:120337294-120337316 GTGGGGGCGCTGTTGGAGGAGGG - Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062150612 9:135016930-135016952 CTGGGGGCCCAGATTGTGCAGGG + Intergenic
1062376745 9:136265266-136265288 CTGGGGGCACATGTGGAGGGGGG - Intergenic
1203744930 Un_GL000218v1:36337-36359 GTGGGAGCACAGTGGGCGCAGGG + Intergenic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190543398 X:51500474-51500496 CTGGGGGCATACTTGTGGCAGGG + Intergenic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1190919690 X:54840148-54840170 CTGGGGGCAGAGGTGGAGGGTGG + Intergenic
1191695498 X:63985770-63985792 CTGGTGGCAGTGTTGGTGCAAGG - Intergenic
1193883794 X:86960290-86960312 CTAGGGGCACTGTTGGTGCTGGG + Intergenic
1195067206 X:101248398-101248420 CTTGGGGCATGGTTGGAACAGGG + Intronic
1196066212 X:111467536-111467558 CTGGGGCCAAAGTTGGAGAGGGG + Intergenic
1197024097 X:121726724-121726746 CTTGGGGCACAGTAGCAGAATGG - Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic
1199677440 X:150200008-150200030 CCGGGGGCATGGTTGGAGCTTGG + Intergenic