ID: 938022144

View in Genome Browser
Species Human (GRCh38)
Location 2:127914857-127914879
Sequence CCACTCTGCCTGGCCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938022144_938022147 4 Left 938022144 2:127914857-127914879 CCACTTTTGGCCAGGCAGAGTGG No data
Right 938022147 2:127914884-127914906 TGCCTGTTATCCCAGCACTTTGG 0: 603
1: 92837
2: 232266
3: 241419
4: 215441
938022144_938022153 17 Left 938022144 2:127914857-127914879 CCACTTTTGGCCAGGCAGAGTGG No data
Right 938022153 2:127914897-127914919 AGCACTTTGGGAGGCTGAGACGG 0: 3970
1: 70797
2: 155803
3: 155906
4: 110799
938022144_938022148 5 Left 938022144 2:127914857-127914879 CCACTTTTGGCCAGGCAGAGTGG No data
Right 938022148 2:127914885-127914907 GCCTGTTATCCCAGCACTTTGGG 0: 1214
1: 221990
2: 272677
3: 184631
4: 142399
938022144_938022155 21 Left 938022144 2:127914857-127914879 CCACTTTTGGCCAGGCAGAGTGG No data
Right 938022155 2:127914901-127914923 CTTTGGGAGGCTGAGACGGGAGG 0: 1029
1: 27077
2: 118408
3: 171909
4: 178679
938022144_938022156 30 Left 938022144 2:127914857-127914879 CCACTTTTGGCCAGGCAGAGTGG No data
Right 938022156 2:127914910-127914932 GCTGAGACGGGAGGATTGCTTGG 0: 4
1: 81
2: 699
3: 2473
4: 5462
938022144_938022150 8 Left 938022144 2:127914857-127914879 CCACTTTTGGCCAGGCAGAGTGG No data
Right 938022150 2:127914888-127914910 TGTTATCCCAGCACTTTGGGAGG 0: 1624
1: 296103
2: 266546
3: 153440
4: 135819
938022144_938022154 18 Left 938022144 2:127914857-127914879 CCACTTTTGGCCAGGCAGAGTGG No data
Right 938022154 2:127914898-127914920 GCACTTTGGGAGGCTGAGACGGG 0: 3188
1: 70544
2: 188333
3: 238173
4: 277224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938022144 Original CRISPR CCACTCTGCCTGGCCAAAAG TGG (reversed) Intergenic
No off target data available for this crispr