ID: 938027179

View in Genome Browser
Species Human (GRCh38)
Location 2:127959884-127959906
Sequence ATGTAATAACTGAAATAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938027174_938027179 28 Left 938027174 2:127959833-127959855 CCCCAAAGTTATAAAAATTTTGG No data
Right 938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG No data
938027177_938027179 26 Left 938027177 2:127959835-127959857 CCAAAGTTATAAAAATTTTGGAA No data
Right 938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG No data
938027176_938027179 27 Left 938027176 2:127959834-127959856 CCCAAAGTTATAAAAATTTTGGA No data
Right 938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG No data
938027178_938027179 3 Left 938027178 2:127959858-127959880 CCAAATAGAAATTAAAGAAATAA No data
Right 938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938027179 Original CRISPR ATGTAATAACTGAAATAAGA CGG Intronic
No off target data available for this crispr