ID: 938030332

View in Genome Browser
Species Human (GRCh38)
Location 2:127986805-127986827
Sequence CGCCACGGCCAAGCATACTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 27}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938030332_938030343 22 Left 938030332 2:127986805-127986827 CCGGAGTATGCTTGGCCGTGGCG 0: 1
1: 0
2: 0
3: 7
4: 27
Right 938030343 2:127986850-127986872 GGTGCTAGCACTCTGGCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
938030332_938030342 21 Left 938030332 2:127986805-127986827 CCGGAGTATGCTTGGCCGTGGCG 0: 1
1: 0
2: 0
3: 7
4: 27
Right 938030342 2:127986849-127986871 TGGTGCTAGCACTCTGGCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 180
938030332_938030338 1 Left 938030332 2:127986805-127986827 CCGGAGTATGCTTGGCCGTGGCG 0: 1
1: 0
2: 0
3: 7
4: 27
Right 938030338 2:127986829-127986851 TGAGCCCTGGGCGGGAGCGTTGG 0: 1
1: 0
2: 0
3: 21
4: 244
938030332_938030337 -7 Left 938030332 2:127986805-127986827 CCGGAGTATGCTTGGCCGTGGCG 0: 1
1: 0
2: 0
3: 7
4: 27
Right 938030337 2:127986821-127986843 CGTGGCGATGAGCCCTGGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 152
938030332_938030336 -8 Left 938030332 2:127986805-127986827 CCGGAGTATGCTTGGCCGTGGCG 0: 1
1: 0
2: 0
3: 7
4: 27
Right 938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG 0: 1
1: 0
2: 1
3: 6
4: 107
938030332_938030341 15 Left 938030332 2:127986805-127986827 CCGGAGTATGCTTGGCCGTGGCG 0: 1
1: 0
2: 0
3: 7
4: 27
Right 938030341 2:127986843-127986865 GAGCGTTGGTGCTAGCACTCTGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938030332 Original CRISPR CGCCACGGCCAAGCATACTC CGG (reversed) Exonic
900547898 1:3238694-3238716 CTCCACGGCCAAGCTCCCTCCGG - Intronic
901892001 1:12274792-12274814 CACCACGGCCCAGCATCCACTGG - Intronic
907505533 1:54915401-54915423 CTCAATGGCCAAGCATACCCAGG + Intergenic
919504725 1:198384930-198384952 GGCCACGGCCAACCTTACACAGG - Intergenic
922506209 1:226127310-226127332 CGCCGCGGCCAAGAAGACGCTGG + Intergenic
923120289 1:230983818-230983840 CGCAAGGACCAAGCATACTCTGG - Intronic
1075306229 10:121370093-121370115 CGCCCCGGCAAAGAATTCTCTGG + Intergenic
1077161753 11:1116475-1116497 AGCCCCGGCCCAGCACACTCAGG - Intergenic
1081545029 11:44065870-44065892 GGCCGCAGCCAAGCATACTTTGG + Intergenic
1081662377 11:44895947-44895969 TGACAAGGCCAAGCATCCTCGGG - Intronic
1083258582 11:61510898-61510920 AGCCAGGGCCAAGGACACTCAGG + Exonic
1085236232 11:75017600-75017622 CTCCTCAGCCCAGCATACTCAGG - Intronic
1089121239 11:116137174-116137196 CGCCCCGGCCCAGCTTTCTCAGG + Intergenic
1096505023 12:52087267-52087289 TGTCACGTCCAAGCATACTCCGG + Intergenic
1104475475 12:129067354-129067376 CACCACGGCCCAGCATTCTCTGG + Intergenic
1122315570 14:100824351-100824373 CCCCACGGCCAATCAGACGCCGG - Intergenic
1139602009 16:67992867-67992889 CTCCACAGCCCTGCATACTCTGG + Intronic
1141756002 16:85991403-85991425 AGCCACAGCCATGCAAACTCAGG - Intergenic
1163730606 19:18947144-18947166 CGCCACAGCCAAAAATAATCGGG - Intergenic
1165160508 19:33813011-33813033 GCCCACGGCCAAGTATACACAGG - Exonic
926703240 2:15818207-15818229 GGCCAAGACCAAGCAAACTCTGG + Intergenic
938030332 2:127986805-127986827 CGCCACGGCCAAGCATACTCCGG - Exonic
1175520401 20:59599136-59599158 CCCCACGGCCAAGCTGGCTCCGG - Intronic
1176418879 21:6498870-6498892 CGCCGCGGCCGAGCTTTCTCCGG - Intergenic
1179304910 21:40144987-40145009 CGCTCCTGCCATGCATACTCAGG - Intronic
1179694373 21:43107192-43107214 CGCCGCGGCCGAGCTTTCTCCGG - Intronic
950099861 3:10350118-10350140 CCCAACGGACAAGCATACCCTGG - Exonic
1002304508 5:178275254-178275276 CCCCACGGGCAAGCAGACACTGG + Intronic
1003097726 6:3155856-3155878 TGCCACGGCTAAGCACACTCAGG - Intronic
1003258016 6:4490753-4490775 AGCCACAGCCCAGCATACTCTGG + Intergenic
1024161744 7:46683128-46683150 CGCCAGGGCCAAGCAGAGACAGG + Intronic
1034161346 7:148996186-148996208 TGCCCCGGCCAACCAAACTCTGG + Intergenic
1037758662 8:21727606-21727628 CCCCAAGGCCAGGCATGCTCCGG + Intronic
1039440838 8:37594347-37594369 CGCCAAGGCCAGGCCTACTCTGG + Intergenic
1061138507 9:128750580-128750602 CGCCACGGCCCCGCATGCTCTGG - Intronic