ID: 938030336

View in Genome Browser
Species Human (GRCh38)
Location 2:127986820-127986842
Sequence CCGTGGCGATGAGCCCTGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938030328_938030336 12 Left 938030328 2:127986785-127986807 CCATCTGTGGCAGGTTTCTTCCG 0: 1
1: 0
2: 2
3: 2
4: 165
Right 938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG 0: 1
1: 0
2: 1
3: 6
4: 107
938030327_938030336 13 Left 938030327 2:127986784-127986806 CCCATCTGTGGCAGGTTTCTTCC 0: 1
1: 0
2: 1
3: 22
4: 220
Right 938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG 0: 1
1: 0
2: 1
3: 6
4: 107
938030332_938030336 -8 Left 938030332 2:127986805-127986827 CCGGAGTATGCTTGGCCGTGGCG 0: 1
1: 0
2: 0
3: 7
4: 27
Right 938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG 0: 1
1: 0
2: 1
3: 6
4: 107
938030324_938030336 26 Left 938030324 2:127986771-127986793 CCAGGTCTACTCACCCATCTGTG 0: 1
1: 1
2: 1
3: 17
4: 154
Right 938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG 0: 1
1: 0
2: 1
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938030336 Original CRISPR CCGTGGCGATGAGCCCTGGG CGG Exonic
900139314 1:1132863-1132885 CCGTGAGGATGAGCCCTGGCCGG - Intergenic
900636366 1:3667937-3667959 CAGTGGCCATGAGCCCTGGGGGG - Intronic
900641749 1:3690923-3690945 CCGTGGCGAGGTGCCGTGCGGGG - Intronic
902412078 1:16217578-16217600 GCGTGGCGCTGAGCCTTGGTTGG - Intergenic
904006642 1:27366511-27366533 CCGTGGCGCTGAGCCGGGGCCGG - Exonic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
915393332 1:155563072-155563094 CTGCGGCGAGGAGCCCAGGGAGG - Intergenic
915409448 1:155688929-155688951 CCGCGGCGACGAACCCAGGGAGG - Intronic
923787473 1:237081895-237081917 ACTTGGCGATGATCCCTGGGAGG + Intronic
924945593 1:248844693-248844715 CCTTGGGCATGTGCCCTGGGAGG + Intronic
1069591611 10:69645449-69645471 CCTTGGTGCTCAGCCCTGGGCGG + Intergenic
1071522822 10:86341507-86341529 CCGTGGCCGGGAGCCCTGTGGGG - Intronic
1081675716 11:44967870-44967892 GGGTGGAGATGGGCCCTGGGAGG + Intergenic
1081774128 11:45665924-45665946 CCGCGGCGAGGGGCGCTGGGGGG - Intergenic
1084261579 11:67982299-67982321 CGGTGGCGATCAGCCCAGGTGGG + Intergenic
1084811063 11:71611812-71611834 CGGTGGCGATCAGCCCAGGTGGG - Intergenic
1089493280 11:118896572-118896594 CCCTGGCCATGGACCCTGGGAGG + Exonic
1089865494 11:121627796-121627818 GCGTGGGGGTCAGCCCTGGGAGG - Intronic
1090306139 11:125692964-125692986 CCTGGGCGATGAGTCCTGGGTGG - Intergenic
1102961839 12:117098547-117098569 CGGAGGCGGGGAGCCCTGGGAGG - Intronic
1103935796 12:124475856-124475878 CCGTGGGGCTGAGCCATGTGGGG + Intronic
1113643589 13:111976231-111976253 CCGTGATAATGAGCCCTGGCTGG + Intergenic
1113727880 13:112618593-112618615 TCGAGACGCTGAGCCCTGGGAGG + Intergenic
1117038325 14:51748818-51748840 CGGTGGCGATCAGCCCAGGTGGG - Intergenic
1119199037 14:72739586-72739608 CCATGGGCATGAGCCCAGGGAGG + Intronic
1121091941 14:91188980-91189002 CAGTGGTGATGAGCACTGAGCGG - Exonic
1122093103 14:99352916-99352938 CAGTGGGGAGGAGGCCTGGGAGG + Intergenic
1122263747 14:100537350-100537372 CCGGGACGATGGGCCGTGGGAGG + Exonic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1127293788 15:57592221-57592243 CCGGGGAGTTGAGCCCAGGGTGG - Intronic
1129909282 15:79212815-79212837 CCTGTGTGATGAGCCCTGGGAGG - Intergenic
1132822195 16:1879831-1879853 CTGTGGCCATGAGCCCTCTGGGG - Intronic
1134057385 16:11178967-11178989 CCGTGTCTCTGAGCCCCGGGTGG + Exonic
1134268156 16:12709408-12709430 CCACGGAGAGGAGCCCTGGGTGG + Intronic
1136924743 16:34361760-34361782 CTGTGGAGTTGAACCCTGGGAGG - Intergenic
1136979830 16:35050046-35050068 CTGTGGAGTTGAACCCTGGGAGG + Intergenic
1138591209 16:58000614-58000636 CCGGGGCGAGGAGCGCCGGGAGG + Intronic
1138857481 16:60712028-60712050 CAGTGTGGATGAGCCCAGGGTGG + Intergenic
1139292335 16:65870216-65870238 CCCTGGCTGTGAGCCCTTGGAGG - Intergenic
1141665357 16:85462860-85462882 CCGCGGCGTGGAGCCCGGGGAGG - Intergenic
1142113265 16:88343207-88343229 CCGTGGCCCTGAGCTCTGGACGG - Intergenic
1142434084 16:90046341-90046363 CAGGGGCCATGAGGCCTGGGTGG + Intergenic
1142639455 17:1277438-1277460 CCTTGGAGCTGACCCCTGGGTGG - Intergenic
1143627875 17:8121560-8121582 CCTTGGCCCTGAGCCTTGGGGGG - Exonic
1143873501 17:9974833-9974855 GGGTGGGGGTGAGCCCTGGGTGG - Intronic
1147264354 17:39225792-39225814 CCGCGGGGATGAGCCGAGGGAGG + Exonic
1152611377 17:81316456-81316478 CCCTGGCCCTGAGCCCTGGAGGG + Intronic
1159943323 18:74425666-74425688 CCCTGGGGAAGAGCCCAGGGAGG + Intergenic
1160909833 19:1469360-1469382 GCGGGGCGAGGCGCCCTGGGGGG - Exonic
1165328020 19:35125417-35125439 CCCTGGCGATGAGCAGTGGCTGG + Exonic
1166270694 19:41711684-41711706 CCATGGCAATGAGCCATGCGGGG - Intronic
1167620378 19:50556931-50556953 CCGTGGCAATGGGCCGGGGGCGG + Intronic
929592790 2:43157993-43158015 TCGTGGCGATGAGCCATCTGGGG - Intergenic
930120723 2:47758501-47758523 CCATGGCGCTTGGCCCTGGGTGG - Intronic
932598249 2:73107536-73107558 CCCTGGCCCTGAGCCCTGGCTGG - Intronic
932776362 2:74530329-74530351 CGGTGGCGCTGGGCGCTGGGGGG + Exonic
937251668 2:120527792-120527814 GCCTGGGGATGAGTCCTGGGTGG + Intergenic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
938708852 2:133957978-133958000 ACGTGGCTATGAGCCATGGCGGG + Intergenic
1176216731 20:63951625-63951647 CCTGGGTGGTGAGCCCTGGGTGG - Intronic
1181038851 22:20182486-20182508 CCTTGCAGCTGAGCCCTGGGAGG + Intergenic
1183098028 22:35566025-35566047 CCGTAGCGATGGGCACTGGGAGG - Intergenic
1183676316 22:39300721-39300743 GTGTGGCCATGAGGCCTGGGAGG + Intergenic
1184470293 22:44692241-44692263 CCGGGAGGAGGAGCCCTGGGTGG - Intronic
1184470340 22:44692358-44692380 CCGGGAGGAGGAGCCCTGGGAGG - Intronic
1184470420 22:44692562-44692584 CCGGGAGGAGGAGCCCTGGGTGG - Intronic
1185394963 22:50582281-50582303 CGTTGGCGAGGAGCCCCGGGAGG - Exonic
950643036 3:14360621-14360643 CCATGGGGCTGAGACCTGGGGGG - Intergenic
954324959 3:49858535-49858557 ACGTGGCAATGAGACCTGGCAGG - Exonic
954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG + Intergenic
955429083 3:58823215-58823237 CCTTGGCGATGAATCCAGGGTGG + Intronic
957076652 3:75607872-75607894 CGGTGGCGATCAGCCCAGGTGGG + Intergenic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
966919417 3:184602218-184602240 CGGTGTCGCTGACCCCTGGGCGG + Intronic
968594143 4:1473753-1473775 CCCTGCCTGTGAGCCCTGGGTGG + Intergenic
969020107 4:4134166-4134188 CGGTGGCGATCAGCCCAGGTGGG + Intergenic
969423323 4:7109652-7109674 CCCTTGCTATGTGCCCTGGGAGG + Intergenic
971099490 4:23447598-23447620 CAGTGGTGATGAGCACTTGGGGG + Intergenic
975933620 4:79555693-79555715 GTGTGGCGATTAGGCCTGGGTGG + Intergenic
980406424 4:132358261-132358283 CTGAGGCAATGAGCCTTGGGCGG + Intergenic
984758479 4:183344657-183344679 AAGGGGCGATGGGCCCTGGGCGG - Intergenic
984833805 4:184000436-184000458 CCGTGGGGATGATGGCTGGGAGG - Intronic
995610983 5:113910046-113910068 CTGTGTCCCTGAGCCCTGGGAGG + Intergenic
998402016 5:141853067-141853089 CTGTTGCGCTGTGCCCTGGGGGG - Intergenic
1001603849 5:172946311-172946333 CTGTGGGGATGGGGCCTGGGAGG - Intronic
1002709219 5:181184167-181184189 CCGGGGCGAGGGACCCTGGGCGG + Intergenic
1003071986 6:2951992-2952014 CTGGGGCGATGATCCCAGGGAGG - Intronic
1007682606 6:43644958-43644980 CCGTGGGGAGGAGGTCTGGGCGG + Intergenic
1015976493 6:138796235-138796257 CCCAGGCGATGTGCCCCGGGCGG - Intronic
1017882750 6:158573092-158573114 CTGTGGCAGTGACCCCTGGGGGG + Intronic
1018035303 6:159876389-159876411 CCGTGTGGATGAGAGCTGGGTGG + Intergenic
1018764872 6:166925369-166925391 CAGTGTAGATGAGGCCTGGGTGG - Intronic
1019335387 7:480307-480329 CCGAGGGCAAGAGCCCTGGGGGG + Intergenic
1029078635 7:97955140-97955162 CGGTGGCGATCAGCCCAGGTGGG + Intergenic
1031164652 7:118214117-118214139 CCGTGGAGCTGAGCCCAGGACGG - Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1038022503 8:23562135-23562157 TCTTGGGGATGAGCCCTGGCTGG - Intronic
1038963435 8:32547837-32547859 CCGTGGTCAGGAACCCTGGGAGG - Intronic
1040886298 8:52267160-52267182 CAGTGGGGATGAACCCTGAGGGG + Intronic
1044373750 8:91445438-91445460 CCATGGCCATGAGCCTTAGGAGG - Intergenic
1048484322 8:134832609-134832631 CCGTGAGGAGGAGCCGTGGGCGG + Intergenic
1049419832 8:142511594-142511616 CCGAGGTGCTGAGGCCTGGGGGG - Intronic
1061165415 9:128919522-128919544 CCTTAGTGATGAGGCCTGGGTGG + Intergenic
1062033214 9:134371397-134371419 CCGTGGCTATGAGCCCAGGTGGG + Intronic
1062428383 9:136516438-136516460 CCGGGGCGCAGAGCCCAGGGAGG - Intronic
1062519465 9:136951733-136951755 CTGTGGCCATGAGGCCGGGGTGG - Intronic
1062540833 9:137040962-137040984 CCGTGCCGAGAAGCCCAGGGTGG + Exonic
1185476610 X:419321-419343 GCGTGGCGAGGTGCCCGGGGAGG - Intergenic
1188451176 X:30309216-30309238 GTGCGGCGATGAGCCCGGGGTGG - Exonic
1191030172 X:55961258-55961280 CTGTGGTGGTGAGGCCTGGGTGG - Intergenic
1195296255 X:103481100-103481122 CTGTGGTGCTGACCCCTGGGTGG + Intergenic
1195302341 X:103542976-103542998 CTGTGATGCTGAGCCCTGGGTGG - Intergenic
1202369494 Y:24187343-24187365 CAGTGGTGATGTGGCCTGGGAGG - Intergenic
1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG + Intergenic