ID: 938032781

View in Genome Browser
Species Human (GRCh38)
Location 2:128009646-128009668
Sequence GTCTGCTAAAAACTCCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938032778_938032781 15 Left 938032778 2:128009608-128009630 CCAGGCTGAACCAACTGAAACTT No data
Right 938032781 2:128009646-128009668 GTCTGCTAAAAACTCCACTAAGG No data
938032779_938032781 5 Left 938032779 2:128009618-128009640 CCAACTGAAACTTCAGATCATTG No data
Right 938032781 2:128009646-128009668 GTCTGCTAAAAACTCCACTAAGG No data
938032777_938032781 22 Left 938032777 2:128009601-128009623 CCAGCAACCAGGCTGAACCAACT No data
Right 938032781 2:128009646-128009668 GTCTGCTAAAAACTCCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938032781 Original CRISPR GTCTGCTAAAAACTCCACTA AGG Intronic
No off target data available for this crispr