ID: 938036145

View in Genome Browser
Species Human (GRCh38)
Location 2:128036648-128036670
Sequence AAACTAGTTCAGGCTGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 3, 1: 3, 2: 48, 3: 256, 4: 509}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938036145_938036150 2 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036150 2:128036673-128036695 CAGGTGTCTTTGGGTCCCCTTGG No data
938036145_938036149 -7 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG No data
938036145_938036154 12 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036154 2:128036683-128036705 TGGGTCCCCTTGGTGGAGAGGGG No data
938036145_938036153 11 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036153 2:128036682-128036704 TTGGGTCCCCTTGGTGGAGAGGG No data
938036145_938036148 -8 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036148 2:128036663-128036685 ACTAGTTTTTCAGGTGTCTTTGG No data
938036145_938036151 5 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036151 2:128036676-128036698 GTGTCTTTGGGTCCCCTTGGTGG No data
938036145_938036152 10 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036152 2:128036681-128036703 TTTGGGTCCCCTTGGTGGAGAGG No data
938036145_938036155 13 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036155 2:128036684-128036706 GGGTCCCCTTGGTGGAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938036145 Original CRISPR AAACTAGTTCAGGCTGTGAC AGG (reversed) Intergenic
900434283 1:2620894-2620916 AAACGAGTTCAGGCCATGATGGG + Intronic
900663559 1:3798547-3798569 AAACTAGTTCAGGCCATGATGGG + Intergenic
900847145 1:5113062-5113084 AAACTAGTTCAGGCCATGATGGG - Intergenic
901118254 1:6866731-6866753 AAACTATGTCAGACTGTGCCCGG + Intronic
901131754 1:6966087-6966109 CATCTAGGTCAGCCTGTGACAGG - Intronic
902429711 1:16353332-16353354 AGACTGGTTCAGGCCATGACGGG + Intronic
902541778 1:17160859-17160881 ACACTAGTTCAGGCCATGATGGG - Intergenic
902997622 1:20239055-20239077 AAACTAGGTCAGGCCATGATGGG + Intergenic
903054768 1:20627979-20628001 AAAGTAGTTCAGGCCATGATAGG + Intergenic
903206985 1:21789860-21789882 AGACTGGTTCAGGCCTTGACAGG + Intergenic
903309556 1:22443941-22443963 AAACTAGTTCAAGCCATGATGGG - Intergenic
903519224 1:23934809-23934831 AAATTAGTTCAGGCCATGATGGG - Intergenic
903693359 1:25190013-25190035 GAACTAGTCCAGGCTGTCCCAGG - Intergenic
904761993 1:32811950-32811972 AAACTAGTTCAGGCCAAGGCAGG + Intronic
905593997 1:39189777-39189799 AAAGCAGTACAGGCTGTGTCAGG - Intronic
907971212 1:59383500-59383522 AAACCAGTTCAGGCCATGATGGG + Intronic
908040211 1:60104659-60104681 AGTCTACTTCAGGCTGTGAATGG - Intergenic
908092521 1:60701072-60701094 AAAGTAGTTTAGGCTGCGATGGG - Intergenic
908331668 1:63076917-63076939 CAACTAGTTCAGGCTTTGGAGGG + Intergenic
909199891 1:72677739-72677761 AATCTAGTTCAGGCCATGATAGG - Intergenic
909259241 1:73465702-73465724 AAACTAGTTCAGGCCATGATGGG - Intergenic
909474178 1:76063423-76063445 AAACTAGTGCAGGCCATGATGGG - Intergenic
910195988 1:84640163-84640185 AAACTAGTTCAGGCCACGATGGG - Intergenic
910344916 1:86225534-86225556 AGACTAATTCAGGGTGAGACTGG + Intergenic
911407611 1:97462494-97462516 AAACTAGTTCAGACCATGATGGG + Intronic
911740203 1:101378745-101378767 AAACTAGTTCAGGTCACGACAGG - Intergenic
913281072 1:117185531-117185553 AAAGTAGTTCAGGCCGTGATAGG + Intronic
913414318 1:118588747-118588769 AAACTAGTTCAGGCCATGATGGG - Intergenic
913669096 1:121078614-121078636 AAACTAGTTCAGGCCATGATGGG + Intergenic
914006048 1:143733363-143733385 AAGCTGTTTCTGGCTGTGACAGG + Intergenic
914020841 1:143866019-143866041 AAACTAGTTCAGGCCATGATGGG + Intergenic
914098525 1:144564598-144564620 AAGCTGTTTCTGGCTGTGACAGG + Intergenic
914267137 1:146047899-146047921 AAACTAGTTCAGGCCATGATGGG + Intergenic
914659339 1:149773961-149773983 AAACTAGTTCAGGCCATGATGGG + Intergenic
915632366 1:157162490-157162512 AATCTAGTTCAGGCCATGATGGG - Intergenic
915641833 1:157233548-157233570 AAACTAGGTCAGGCCCTGAGGGG + Intergenic
916301263 1:163276907-163276929 AAACTAGTACAGGTCATGACAGG + Intronic
917098004 1:171418855-171418877 AAACTAGTTCAGGCCATAACGGG - Intergenic
917150871 1:171943332-171943354 AAACTAGTTCAGGACATGATGGG + Intronic
917152899 1:171963916-171963938 ATACTAGTTCAGGCCATGATAGG + Intronic
917257038 1:173126662-173126684 AAACTAGTTCTGGCCATGATGGG - Intergenic
917458409 1:175205667-175205689 AAACTAGTTCAGGCCTTAATGGG - Intergenic
917995468 1:180434106-180434128 AAACTAGTTCAGGCCATGATGGG + Intronic
919190742 1:194214899-194214921 AAACTGGTTCAGGCCATGATGGG - Intergenic
919596547 1:199570788-199570810 AGACTGGTTCAGGCCATGACAGG + Intergenic
919829917 1:201532999-201533021 AGACTATTTCAGGCCATGACAGG - Intergenic
920010946 1:202867306-202867328 AAACTAGTTCAGGTTATGATGGG - Intergenic
920596569 1:207278255-207278277 AAACTATTTCAGGCTGGGCATGG + Intergenic
920769626 1:208869234-208869256 AAACTAATTCAGGCTGGGTGCGG - Intergenic
920940002 1:210473370-210473392 AAACTAGTTCAGGCCATCATGGG - Intronic
921665851 1:217869772-217869794 AAACTAGTTCAGGCCATTATAGG - Exonic
921776068 1:219101667-219101689 AAACTAGTTCAGGCCATGATGGG + Intergenic
922047918 1:221964664-221964686 ACACTAGTTCAGGCCATGATGGG + Intergenic
922075202 1:222236744-222236766 AAACTAGTTCAGGCCATGGTGGG - Intergenic
922152747 1:223019361-223019383 AAACTAGTTCAGGCCTTGACAGG + Intergenic
922166463 1:223119515-223119537 AAACTAGTTCAGGCCATGATGGG + Intronic
922609717 1:226916827-226916849 AAACTGGTTCAGGCCATGATGGG + Intronic
922895093 1:229093746-229093768 AAACCAGTTTAGGCCATGACGGG + Intergenic
923175893 1:231464608-231464630 ACACTAGTTCAGGCCATGATGGG - Intergenic
923215545 1:231845151-231845173 AGACTGGCTCAGGCTATGACGGG - Intronic
923384511 1:233453167-233453189 ACACCAGTTGAGGCTGTGATGGG + Intergenic
923666082 1:235999844-235999866 AAACTACTTCAGGCCATGAGAGG + Intronic
924903269 1:248424993-248425015 AAACTAGTTCAGGCCATGACAGG - Intergenic
924920162 1:248620541-248620563 AAACTAGTTCAGGCCATGATAGG + Intergenic
924938275 1:248790679-248790701 AAACTAGTTCAGGCCATCATGGG - Intergenic
1062770671 10:98155-98177 AAACGAGTTCAGGCTATGATGGG + Intergenic
1062824998 10:560785-560807 AAACTAGTCCAGGCCATGATCGG + Intronic
1063028076 10:2202600-2202622 AAACTAGTTCAGGCCATGACAGG - Intergenic
1063886959 10:10589422-10589444 AAACTAGCTGAGGCTATGATGGG - Intergenic
1064184829 10:13152495-13152517 AAACTAGTTTAGGCCATGATGGG + Intergenic
1064520210 10:16193002-16193024 AAACTAGTTTAGGCTATGATGGG + Intergenic
1064619783 10:17203152-17203174 AAACTAGTTCAGGCCATGCTGGG - Intergenic
1064658988 10:17586946-17586968 AGACTGGTTCAGGCCATGACAGG + Intergenic
1064804787 10:19118703-19118725 AAACTAGTTCAGGCCATGATGGG - Intronic
1065006686 10:21386940-21386962 AAACTAGTTCAGGCCATGATGGG + Intergenic
1065009222 10:21406522-21406544 AAACTAGCTCAGGCCATGACGGG - Intergenic
1065058149 10:21868791-21868813 AAACTAGGTCAGGCCATGATGGG + Intronic
1065209899 10:23392964-23392986 AAACTAGTTCAGGCCATGATGGG - Intergenic
1065265454 10:23970777-23970799 ACACTAGTTCAGGCCATGATAGG + Intronic
1065456141 10:25908637-25908659 AAACTGGTTCAGGCCATGACAGG - Intergenic
1065838855 10:29683499-29683521 TAACTAGTTCAGGCCCTGATGGG - Intronic
1066040242 10:31542010-31542032 AAACTAGTTCAGGCCATGATGGG + Intergenic
1066102633 10:32131574-32131596 AAACTGGTTCAGGCCATGACAGG + Intergenic
1066192891 10:33071994-33072016 AAACTAGTTCAAGCTGTGATGGG + Intergenic
1066209929 10:33226565-33226587 AAACTAGTTCAGGCTATGATAGG + Intronic
1066290665 10:34011753-34011775 AAACTAGTTCAGGCCATTATGGG + Intergenic
1066336830 10:34486289-34486311 AAACTAGTTCGGGCCATGATGGG - Intronic
1067341470 10:45408684-45408706 AAATTAGTTCAGGCCATGATAGG - Intronic
1067399173 10:45955382-45955404 ACACTAGTTCAGGCCATGATGGG + Intergenic
1067538405 10:47134234-47134256 AGACTGGTTCAGGCCATGACTGG - Intergenic
1067856334 10:49796760-49796782 AACCTAGTTCAGGCCGTGATGGG - Intergenic
1067867491 10:49924598-49924620 ACACTAGTTCAGGCCATGATGGG + Intronic
1068047557 10:51907094-51907116 AAACTAGTTCAGGCCATGATGGG - Intronic
1068177207 10:53476939-53476961 AAACTAGTTCAGGCCATGATGGG - Intergenic
1068365069 10:56037473-56037495 AAAACAGTTCAGGCCATGACGGG - Intergenic
1068505379 10:57893606-57893628 ACACTAGTTCAGGCCATGATGGG - Intergenic
1068677349 10:59781818-59781840 AAACTATTTCAGGCTGGGCACGG + Intergenic
1069248714 10:66243024-66243046 AAACTAGTTCAGGCCATCATGGG + Intronic
1069410882 10:68152314-68152336 AAACTAGTTCAGGTCATGATGGG - Intronic
1069423926 10:68272938-68272960 AAACTAGCTCAGGCCATGATGGG + Intergenic
1069542339 10:69304645-69304667 AAGTTAGTTCAGCCTATGACCGG + Intronic
1071032090 10:81196833-81196855 AAACTAGCTTAGGCCATGACAGG + Intergenic
1071858819 10:89651858-89651880 AAACTAGTTCAGGCCATGATGGG - Intergenic
1071863031 10:89695486-89695508 AAACTAGTTCGGGCCATGATGGG + Intergenic
1071959474 10:90796132-90796154 AAACCAGTTCAGGCCATGATAGG - Intronic
1072357683 10:94627671-94627693 AGACTGGTTCAGGCCATGACGGG + Intergenic
1072689427 10:97562018-97562040 AAACGAGTTCAGGCCATGATGGG + Intronic
1072715124 10:97746336-97746358 AAACTATTTCAGGCTGGGTGCGG - Intronic
1073396245 10:103220170-103220192 AAACTAGTTCAAGCCTTGATGGG - Intergenic
1073483811 10:103804199-103804221 AGACTGGTTCAGGCCATGACAGG - Intronic
1074228071 10:111506871-111506893 AAACTAGTTCAGGCCATGATGGG - Intergenic
1074842405 10:117368095-117368117 AAACTAGTTCATGCTATTATAGG - Intronic
1074997564 10:118770890-118770912 AAACTAGTTCAGGCCATGATGGG + Intergenic
1076458803 10:130624004-130624026 AAGCTGGTTCAGGCTGGGAACGG - Intergenic
1076822898 10:132949814-132949836 AACCTAGTTCAGGCCATGATGGG - Intergenic
1076823418 10:132953733-132953755 AACTTAGTTCAGGCTGTGATGGG - Intergenic
1076902314 10:133346002-133346024 AAACTAGTTCAGGCCATAATGGG - Intronic
1076977331 11:184199-184221 AGACTGGTTCAGGCTATGATGGG + Intronic
1077324129 11:1956402-1956424 CAGCTGGTTCGGGCTGTGACGGG + Exonic
1078046542 11:7918316-7918338 AAACTAGTTCAGACCATGACCGG + Intergenic
1078385868 11:10892105-10892127 AAACTAGGTCAGGCCATGATGGG - Intergenic
1078552094 11:12288087-12288109 ACACCAGGTCAGGCTGGGACAGG + Intronic
1079891077 11:26053959-26053981 AAACTAGTGCAGGCCATGACAGG - Intergenic
1080010473 11:27453871-27453893 AAACTAGTTCAGACCATGATGGG + Intronic
1080045283 11:27801489-27801511 AAACTTGTTCAGGCCATGATGGG - Intergenic
1080163652 11:29210745-29210767 CAACTAGTTCAGGCCATGAGGGG - Intergenic
1080650944 11:34222366-34222388 AGACTAGTTCAGGCCATGAATGG - Intronic
1080694032 11:34585147-34585169 GAAATAGTTCAGGTGGTGACTGG + Intergenic
1080881692 11:36327268-36327290 AAACTAGTTCATGCCATGATGGG + Intronic
1081323348 11:41717179-41717201 AAACTAGTTCAGGCTGTTACAGG - Intergenic
1081530782 11:43957854-43957876 AAACTAGTTCCGGCCATGACGGG - Intergenic
1082710192 11:56545774-56545796 AGACTAGTTCAGGCGGTTAAGGG + Intergenic
1082866398 11:57903639-57903661 AAACTAGTTCAGGCCACGATGGG - Intergenic
1083083142 11:60114316-60114338 AGTCTAGTTCAGGCTGTGATGGG - Intergenic
1084286375 11:68133894-68133916 AATCTAGTTGAGGCCATGACAGG + Intergenic
1084606710 11:70176707-70176729 AGACTGGTTCAGGCCATGACAGG - Intronic
1084744633 11:71161084-71161106 AAACTAGTTCAAGGTATGATGGG + Intronic
1085481440 11:76825787-76825809 AAACTAGTACAGGCCATGACAGG + Intergenic
1085489664 11:76903518-76903540 AAACTGGTTCAGGCCATGACAGG + Intronic
1085619617 11:78028006-78028028 AAACTAGTTCAGGCCATGACTGG - Intronic
1085796162 11:79541857-79541879 AAACTAGTTCAAGCTATGATGGG + Intergenic
1086203817 11:84234617-84234639 ACACTAGTTCAGGCCATGATGGG + Intronic
1086782279 11:90922231-90922253 AAACTAGTTCAGTCCTTGATGGG - Intergenic
1088087160 11:105995109-105995131 AGACTGGTTCAGGCCATGACAGG - Intergenic
1088330022 11:108641840-108641862 AAGCTAGTTCAGGCCATGATGGG + Intergenic
1089491494 11:118886944-118886966 AAACCAGCTCAGGCTGTTTCTGG + Intronic
1089542578 11:119198794-119198816 GAACTAGTTCAGGCCGTGATGGG + Intergenic
1090051332 11:123382355-123382377 AAACAAGTTCTGGATTTGACTGG - Intergenic
1090185273 11:124734951-124734973 AAACTAGTTCAGGCCATGATGGG + Intergenic
1090290048 11:125535340-125535362 AAACTAGTCCAGGCCATGATGGG + Intergenic
1090877607 11:130804877-130804899 AGACTGGTTGAGGCTGCGACAGG + Intergenic
1091362559 11:134989157-134989179 AGACTGGTTCAGGCCATGACAGG + Intergenic
1202807115 11_KI270721v1_random:11597-11619 CAGCTGGTTCGGGCTGTGACGGG + Intergenic
1091386180 12:96786-96808 AACCTAGTTCAGGCCATGATGGG - Intronic
1091466333 12:688073-688095 AAACTAGTTCAGGCCATGATGGG - Intergenic
1092304037 12:7281258-7281280 AAACTAGTTCAGGCCATAATGGG + Intergenic
1092645717 12:10569880-10569902 AAACTAGTTGAGGCCATGATGGG + Intergenic
1092725967 12:11485819-11485841 AGACTGGCTCAGGCCGTGACGGG + Intronic
1092733370 12:11555888-11555910 AAACTAGCGTAGGCTGTGACTGG + Intergenic
1092895608 12:13007414-13007436 AAACTAGTTCAGGCCATGATGGG + Intergenic
1093130324 12:15384125-15384147 AATCTAGTTCAGGCCATGACTGG - Intronic
1093192034 12:16085981-16086003 AAAGTATTTGAGGCTGTGAAAGG + Intergenic
1093624810 12:21332541-21332563 AAACAAGTTTAGGCTGTTATGGG - Intronic
1093812210 12:23504796-23504818 AAACTAGTTCAGGCCATGATGGG + Intergenic
1094009699 12:25794427-25794449 AAACTTGTTCAGGCCATGATGGG - Intergenic
1094133538 12:27100266-27100288 AAACTAGTTTAGGCCATGATGGG + Intergenic
1094183683 12:27618303-27618325 AAACTAGTTTAGGCCGTGATGGG + Intronic
1094368535 12:29710216-29710238 AAAGTGGTTCAGGCTGTGTTTGG - Intronic
1094425005 12:30308189-30308211 AAACCAGTTCAGGCTATGACAGG - Intergenic
1094522408 12:31206646-31206668 ACACTAGTTCAGGCCATGATAGG + Intergenic
1095268094 12:40183538-40183560 AATCTAGTTCAGGCCATGATGGG + Intergenic
1095332009 12:40977420-40977442 AAACTAGTTCAGGAAGTGATGGG - Intronic
1095497617 12:42801836-42801858 ATACTAGTTCAGGCCATGATGGG - Intergenic
1095582236 12:43813548-43813570 AAAATAGTTCAGGATTTGAAAGG - Intergenic
1095979159 12:47961107-47961129 AAACTAGTTCAGGCCATGATGGG - Intergenic
1096363172 12:51005907-51005929 AAACTAGTTCAGGCCATGATGGG + Intronic
1097157238 12:57021790-57021812 AAACTAGGTCAGGCCATGATGGG + Intronic
1097400124 12:59118387-59118409 AAACTAGTTCAGGCCATGACAGG + Intergenic
1097517674 12:60625280-60625302 AAACTAGTTCAGGTCATGATAGG - Intergenic
1097584814 12:61502975-61502997 AGACTGGTTCAGGCCATGACAGG + Intergenic
1097590314 12:61566596-61566618 TCAATAGTTCAGGGTGTGACTGG + Intergenic
1098508639 12:71284982-71285004 AGACCAGTTCAGGCAGTGCCAGG - Intronic
1098831116 12:75364238-75364260 AAACTAGTTCAGGCCATGATGGG - Intronic
1099168416 12:79335821-79335843 AAACAAGTTCTGGCTGTTGCTGG - Intronic
1099664508 12:85610635-85610657 GAACTTGTTCAGGCTGTGAATGG - Intergenic
1099733279 12:86533785-86533807 AAACTAGTTCAGGTCATGATGGG + Intronic
1099802011 12:87469467-87469489 AAATTAGTTCAGGCCATGATGGG + Intergenic
1100299093 12:93290747-93290769 AAACTACTTCAGGCCATGATGGG + Intergenic
1101211611 12:102540289-102540311 AAAGGAGTTCAGGATGTCACTGG + Intergenic
1101505791 12:105345029-105345051 AAACTAGGTCAGGCCATGATGGG + Intronic
1101678300 12:106939909-106939931 AAACTAGTTCAGGCCATGATGGG - Intergenic
1101679179 12:106948168-106948190 AAACTAGTTCAGGCCAGGATGGG - Intergenic
1102416038 12:112763771-112763793 AAACTAGTTCAGGCCATGGTGGG - Intronic
1102444275 12:112989739-112989761 AAACCAGTTCAGGCCATGATGGG - Intronic
1104302448 12:127576708-127576730 AAACTAGGCCAGTCTGCGACAGG - Intergenic
1104307802 12:127625200-127625222 AAACTGGTTCAGGCCATGACGGG - Intergenic
1104339897 12:127938499-127938521 AAACCAGTTCAGGCCATGGCTGG - Intergenic
1104538000 12:129636497-129636519 AAACTAGCTCAGGCTGTGATAGG - Intronic
1104694062 12:130850114-130850136 AAACCAGTTCAGGCCATGATGGG + Intergenic
1104781810 12:131426446-131426468 AACCTAGTTCAGGCCATGATGGG + Intergenic
1105332879 13:19434268-19434290 AGACTACTTCAGGCTGAGAAGGG + Intronic
1105878818 13:24585514-24585536 AGACTACTTCAGGCTGAGAAGGG - Intergenic
1105921029 13:24963544-24963566 AGACTACTTCAGGCTGAGAAGGG + Intergenic
1105967547 13:25398400-25398422 AAACTAGCTCAGGCCATGATAGG - Intronic
1106434505 13:29712002-29712024 AAACTAGTTTAGGCCATGATGGG - Intergenic
1107155809 13:37165971-37165993 AATCTAGTTCAGGCCATGATGGG + Intergenic
1107911272 13:45107834-45107856 AATCTAGTTCAGGTCGTGATTGG - Intergenic
1108158708 13:47615780-47615802 AAAATAAATCAGGCTGTGAAAGG + Intergenic
1108248413 13:48540814-48540836 AACCTAGTTCAGGCCATGATGGG + Intergenic
1108253891 13:48592580-48592602 AAACTAGTTTAGGCTATGAGGGG - Intergenic
1108390962 13:49947283-49947305 AAACTGGTTCAGGCCATGATGGG + Intergenic
1108613665 13:52109233-52109255 AAACTAGTTCAGGCCATGATGGG + Intronic
1108626224 13:52231130-52231152 AGACTACTTCAGGCTGGGAAGGG + Intergenic
1108659842 13:52575352-52575374 AGACTACTTCAGGCTGGGAAGGG - Intergenic
1109157520 13:58929061-58929083 AAACTAGTTCAGGCCATGATGGG - Intergenic
1109442871 13:62398007-62398029 AAACTGGTTCAGGCTATGATGGG + Intergenic
1109471753 13:62816197-62816219 ATACTAGTTCAGGCCATGACAGG + Intergenic
1110928380 13:81184608-81184630 AATCTAGTTCAGGCCATGATGGG + Intergenic
1110982423 13:81918005-81918027 AAACTAGTTCTGGCCATGATGGG + Intergenic
1111529506 13:89518469-89518491 AAACTAGTTCAGGCCATGACAGG + Intergenic
1111564976 13:90002306-90002328 AAACTAGTTCAGGCCATGACAGG + Intergenic
1112079557 13:95954340-95954362 AAACTAGCTCAGGCCATGATGGG + Intronic
1112261341 13:97880840-97880862 AAACCAGTTCAGGCCATGATGGG + Intergenic
1112281391 13:98065788-98065810 AAACTAGTTCAGCCCATGATGGG - Intergenic
1113535634 13:111064187-111064209 AAACGAGTTCAGGCTATGATGGG + Intergenic
1113609398 13:111632668-111632690 AGACTGGTTCAGGCCATGACGGG - Intronic
1113971857 13:114197436-114197458 AAACTAGTTCAGGCCATGATGGG - Intergenic
1114244873 14:20903777-20903799 AAACTACTTGAGGATGTGATTGG - Intergenic
1114707512 14:24742266-24742288 AAACTAGTTCAGGCCATGATGGG + Intergenic
1114853732 14:26412648-26412670 ACACTAGTGCAGGCCCTGACGGG - Intergenic
1115303468 14:31910946-31910968 AAACTAGTTCAGGCCATGATAGG - Intergenic
1115532711 14:34341962-34341984 AAACTAGTTCAAGCCATGATGGG - Intronic
1115901000 14:38148123-38148145 AATCTAGTTCAGGCCATGATGGG + Intergenic
1118158607 14:63266370-63266392 AAACTAGTTCAGGCTATGATGGG - Intronic
1118441313 14:65814283-65814305 AAGCTAGTTCAGGCCATGATGGG - Intergenic
1118491573 14:66266004-66266026 AAACTAGTTCAGGCCATGATGGG - Intergenic
1120267713 14:82272620-82272642 AAACTAGTTCAGGCCATGATGGG - Intergenic
1120769675 14:88365329-88365351 AAACCAGTTCAGGCCATCACAGG - Intergenic
1122135785 14:99632079-99632101 AACATAGGTCAGGCTGTGCCTGG - Intergenic
1123064455 14:105609950-105609972 AAACCAGTTCAGGCCATGACAGG + Intergenic
1123073757 14:105655589-105655611 AAACCAGTTCAGGCCATGACAGG + Intergenic
1123087758 14:105725168-105725190 AAACCAGTTCAGGCCATGACAGG + Intergenic
1123093723 14:105754544-105754566 AAACCAGTTCAGGCCATGACAGG + Intergenic
1124075721 15:26442777-26442799 AAAGTAGTTCAGGCTATGATGGG - Intergenic
1124208746 15:27744830-27744852 AAACTAATTCAGGCCATGAGGGG + Intergenic
1124230632 15:27943197-27943219 AAACTAGTTCAGGGCATGAAGGG + Intronic
1124603411 15:31152540-31152562 AAACTAGTTCAGGCCATGACGGG + Intronic
1124821974 15:33055034-33055056 CAACTAGTTCAGGCCATGATGGG + Intronic
1125332002 15:38591631-38591653 AAACCAGTTCCCGCTGTGATGGG + Intergenic
1126946030 15:53821532-53821554 AAACTAGTTCAGGCTGTGACAGG + Intergenic
1127321421 15:57850333-57850355 AAACTACTTAGGGCTGTGGCTGG + Intergenic
1127575304 15:60286072-60286094 AAATTAGTTCAGGCCATGATAGG - Intergenic
1127648539 15:60983138-60983160 AAACTAGTTCAGGCCATGATAGG + Intronic
1127901262 15:63342656-63342678 AAACTAGTTCAGGCCATGATGGG - Intronic
1128603479 15:69016929-69016951 AAACTAGTTCAGGCCATCATGGG + Intronic
1130695045 15:86122784-86122806 AGACTAGTTCAGGCCATGATGGG + Intergenic
1130742151 15:86612412-86612434 GAACTAGTTCAGGCCATGATGGG + Intronic
1130889777 15:88123973-88123995 AAACTAGTTCAGACCATGATGGG - Intronic
1131001036 15:88940511-88940533 AAACTAGTTCAGCCCATGATGGG - Intergenic
1131464829 15:92646554-92646576 AAACTAATTCAGGCCATGATGGG + Intronic
1133000061 16:2845774-2845796 AAACTAGCTCAGGCCATGATGGG + Intergenic
1133137130 16:3719927-3719949 AAACTAGTTCAGGCCATAATTGG - Intergenic
1134002108 16:10790966-10790988 GAACTAGTTCAGGCCATGATGGG - Intronic
1134171489 16:11973250-11973272 AAACTAGTTCAGGCCATGATGGG - Intronic
1134338682 16:13325423-13325445 AAACTAGTTCAGGCCATGATGGG - Intergenic
1135059684 16:19260609-19260631 AAGCTAGTTCAGGCTGTGGTGGG - Intronic
1135912557 16:26574688-26574710 AGACTAGTTCAGACCGTGATGGG + Intergenic
1136289593 16:29263503-29263525 AAACAAGTTCAGGCTGTGATGGG - Intergenic
1137302514 16:47165990-47166012 AAAGTAGTTCAGGCCATGACCGG + Intronic
1137814222 16:51383100-51383122 AGACTAGGTCATGCTGTGCCAGG - Intergenic
1138262539 16:55635580-55635602 AAACTAGTTCGGGCCATGACGGG - Intergenic
1138632310 16:58307666-58307688 AAACTAGCTCAGGCCATGATGGG + Intronic
1138947739 16:61872688-61872710 ACACTAGTTTAGGCTGTGATGGG - Intronic
1139709605 16:68765785-68765807 AAACTAGATCCAACTGTGACAGG - Intronic
1140458290 16:75117033-75117055 AAATTAATTCAGGCTGTGATGGG + Intergenic
1140782376 16:78308334-78308356 AAACTAGTTCAGGCAGTGATGGG + Intronic
1141411902 16:83840832-83840854 AAACTAGTTCAGGCCATGATGGG - Intergenic
1142095327 16:88236483-88236505 AAACAAGTTCAGGCTGTGATGGG - Intergenic
1142442921 16:90112483-90112505 AGACTGGTTCAGGCTATGATGGG - Intergenic
1142464782 17:128909-128931 AGACTGGTTCAGGCTATGATGGG + Intergenic
1142880001 17:2876777-2876799 AAACTGGTTCAGGCCATGATGGG - Intronic
1143288713 17:5812203-5812225 AAACAAGTTCAGGCCATGATGGG + Intronic
1144059802 17:11573029-11573051 AAAGTACTTCTAGCTGTGACTGG + Intergenic
1144096854 17:11907536-11907558 AAACTAGTTCAGGCCATGATGGG - Intronic
1144238366 17:13284858-13284880 AAACTAGTTTAGGCCATGATGGG - Intergenic
1144299926 17:13913698-13913720 AAACTAGCTCAGGCCATGATGGG + Intergenic
1144483042 17:15643195-15643217 AAACCAGTTCAGGCCATGATGGG + Intronic
1144693149 17:17282082-17282104 AAACTAGTTCAGGCCATGATGGG + Intergenic
1144915639 17:18721835-18721857 AAACCAGTTCAGGCCATGATGGG - Intronic
1145223370 17:21107355-21107377 AAACTAGTTCAAGCCATGATGGG - Intergenic
1146513085 17:33467460-33467482 AAACTAGTTCAGGCTATGATGGG + Intronic
1146811148 17:35904434-35904456 AAACTAGTTCAGGTCATGATCGG + Intergenic
1147920915 17:43916454-43916476 AAACTAGTTCAGGCCATGATGGG + Intergenic
1148215611 17:45832678-45832700 AAGGTTGTTCAGGCTGTGACTGG + Intronic
1148493757 17:48039648-48039670 AAACTAGTAAAGGCTGGGAATGG - Intergenic
1148951846 17:51320218-51320240 AAACTAGTTCAGGCCATGATAGG - Intergenic
1152137474 17:78513140-78513162 AAATGAGTTCAGGCCATGACGGG + Intronic
1152823895 17:82451643-82451665 AAACTAGCTCAGGCAGTGATGGG + Intergenic
1153023729 18:655768-655790 AAACTAGTTCAGGCCATGATGGG + Intronic
1153121990 18:1739776-1739798 AAACTAATTCAGGCTATGATGGG - Intergenic
1153345391 18:4020230-4020252 AGACTGGTTCAGGCCATGACAGG - Intronic
1153572594 18:6488069-6488091 AAACTAGTTCAGGCCATGATGGG + Intergenic
1153704855 18:7735025-7735047 AAACTAGTTCAGGTCATGAAAGG + Intronic
1153867985 18:9290833-9290855 AAACTAGTTCAGGCCATGGTGGG + Intergenic
1153889059 18:9495632-9495654 AAACTAGTTCAGGCCATGAAGGG + Intronic
1154048419 18:10929896-10929918 AAACCAGTTCAGACAATGACAGG + Intronic
1154114422 18:11598706-11598728 AAACTGCTTCAGGCCATGACAGG + Intergenic
1154489273 18:14907186-14907208 AAACTGGTTCAGGCCATGACAGG - Intergenic
1155197084 18:23485516-23485538 AACCTAGTTCAGGTCATGACAGG + Intronic
1155850490 18:30768458-30768480 AAACTAATTCAGGCAATGATGGG + Intergenic
1156185659 18:34660265-34660287 AAACTAGTTCAGGCCGTGAGAGG + Intronic
1156420554 18:36948021-36948043 AAACAAGTTCAGGCCATGATGGG - Intronic
1157504334 18:48216069-48216091 AAACTAGTTCAAGCCATGAAGGG - Intronic
1157671036 18:49528914-49528936 AAACTAGTTCAGGTCATGATGGG + Intergenic
1157916550 18:51669232-51669254 GACCTAGGTCAGGCTTTGACAGG + Intergenic
1158166755 18:54548846-54548868 AAACTAGTTCAGGCCATGATGGG - Intergenic
1158167387 18:54555695-54555717 AAACTAGTTCAGGCCATGATGGG - Intergenic
1158569287 18:58583347-58583369 AAACTAGTTCAGGCCATGACAGG - Intronic
1158972784 18:62684088-62684110 AAACTAGTTAAGGCCGTAATGGG + Intergenic
1159323543 18:66886884-66886906 AAACTAGTTCAGGCCATGATGGG - Intergenic
1159324364 18:66895061-66895083 AAACTAGTTCAGGCCATGATGGG - Intergenic
1159409863 18:68057682-68057704 CATCTAGATCAGGCTGTGACAGG + Intergenic
1159583941 18:70265020-70265042 AAACTAGTTCAGGCCATGACGGG + Intergenic
1159594160 18:70366576-70366598 AAACAAGTTTAGGATGTGAAAGG - Intergenic
1160186166 18:76678374-76678396 AAACCAGTTCTGGCGGGGACGGG - Intergenic
1161743128 19:6036992-6037014 AAATGAGTTCAGGCTGGGAAGGG + Intronic
1163060870 19:14760711-14760733 AGACTAGTTCAGGCTATGGTGGG + Intronic
1163212384 19:15850714-15850736 AACCTAGTTCAGGCCATGATGGG + Intergenic
1164557274 19:29263334-29263356 CAGCTGGTTCAGGCTGTGATTGG + Intergenic
1164966972 19:32493693-32493715 AAGCTAGTTCAGGCCATGATGGG - Intergenic
1167200792 19:48063679-48063701 AACCTAGTTCTGGCCGTGACAGG + Intronic
1168584228 19:57579615-57579637 AAACTAGTTCAGGACGTGATGGG - Intronic
924979185 2:205138-205160 AAACTAGTTCAGGCCATCATGGG + Intergenic
925078705 2:1042236-1042258 AAACTAATTCATGCTTTGATTGG + Intronic
925353850 2:3223404-3223426 CAGCCAGCTCAGGCTGTGACAGG + Intronic
925981141 2:9178541-9178563 AAACCAGTTCAGGCTGTGACAGG - Intergenic
926951454 2:18248067-18248089 AAATTAATTCAGGCTGTTCCTGG + Intronic
927164151 2:20300119-20300141 GGACTGGTTCAGGCTGTGATGGG - Intronic
927950494 2:27165099-27165121 ACACTAGTTCAGGCCATGATGGG - Intergenic
928243089 2:29603572-29603594 AAACTAGTTCAGACCATGATGGG - Intronic
928604729 2:32935236-32935258 AAACTAGTTCAGGCCATGATGGG + Intergenic
928930293 2:36617171-36617193 AAACCAGTTTAGGCTATGATGGG - Intronic
929481452 2:42312313-42312335 AAACTGGTTCAGGCCGTAACAGG + Intronic
929565725 2:42983239-42983261 AAGCTAGTTCAGGCCATGAGGGG + Intergenic
930150119 2:48050896-48050918 AGACTGGTTCAGGCCTTGACGGG - Intergenic
930488333 2:52036969-52036991 AACCTAGTTCAGGCTATGCTGGG + Intergenic
930946087 2:57077828-57077850 CCACTAGTTTAAGCTGTGACTGG + Intergenic
931004803 2:57836888-57836910 AAACTTGTCCAGCCTGTGACTGG + Intergenic
931042188 2:58313149-58313171 AATCTAGTTCAGGCCATGATGGG - Intergenic
932157286 2:69429736-69429758 AAACTAATTCAGGCTGGGCACGG + Intronic
933079897 2:77972696-77972718 AAACTGGTTCAGGCCATGACAGG + Intergenic
933080027 2:77974519-77974541 AATATAGTTCAGGCCATGACAGG + Intergenic
933228620 2:79779876-79779898 AAACTAGTTCAGGCCATGATGGG + Intronic
933345377 2:81078442-81078464 ACACTAGTTCAGGCCATGATGGG + Intergenic
933840984 2:86285360-86285382 ATACTATTTAAGCCTGTGACAGG + Intronic
934131215 2:88950983-88951005 AAACTAGGTTAGGCCATGACTGG + Intergenic
934133090 2:88968566-88968588 AAACTAGGTTAGGCCATGACTGG + Intergenic
934140567 2:89043259-89043281 AAACTAGGTTAGGCCATGACTGG + Intergenic
934141178 2:89049361-89049383 AAACTAGATTAGGCCATGACTGG + Intergenic
934146874 2:89103567-89103589 AAACTAGGTTAGGCCATGACTGG + Intergenic
934150529 2:89143845-89143867 CAACCACTTCAGTCTGTGACAGG + Intergenic
934220684 2:90079577-90079599 AAACTAGGTTAGGCCATGACTGG - Intergenic
934228063 2:90151188-90151210 AAACTAGATTAGGCCATGACTGG - Intergenic
934228669 2:90157283-90157305 AAACTAGGTTAGGCCATGACTGG - Intergenic
934233329 2:90206817-90206839 AAACTAGGTTAGGCCATGACTGG - Intergenic
934864159 2:97791116-97791138 AAAAAAGCTCAGGCTGTGAAGGG + Intronic
934881366 2:97983359-97983381 AAACTAGTTCAGGCCATGATGGG - Intronic
935281623 2:101522670-101522692 AAAATAGTCCAGGCTGGGCCAGG + Intergenic
936523911 2:113230025-113230047 AAACTAGTTCCTTATGTGACAGG - Intronic
936583906 2:113734417-113734439 AACCTAGTGCAGGATGTGACAGG + Intronic
936586444 2:113762599-113762621 AAACTATTTCAGGCCGTGATGGG - Intergenic
937838071 2:126493930-126493952 AAACTAGTTCAGGCCATGATTGG - Intergenic
937925351 2:127163478-127163500 ACACTAGTTCAGGGTGTGATGGG + Intergenic
938036145 2:128036648-128036670 AAACTAGTTCAGGCTGTGACAGG - Intergenic
938259751 2:129887124-129887146 AAACTAGTTCAGGCCATGATGGG - Intergenic
939308376 2:140438293-140438315 AAAATATTTCAGGCTGGGAGTGG - Intronic
939423119 2:141999250-141999272 AATCTAGTTCAGGCCATGATGGG - Intronic
939447041 2:142323368-142323390 AGACTGGTTCAGGCCATGACTGG + Intergenic
940704134 2:157082773-157082795 AAACTAGTGAAGGCCGTGATGGG + Intergenic
941529955 2:166655865-166655887 AATCCAGTTCAGGCTATGATAGG - Intergenic
941596637 2:167485081-167485103 AAACTTGTTCAGGCCATGATGGG - Intergenic
942097743 2:172549235-172549257 AAACTAGTTCAGGCCATGATGGG + Intergenic
942358699 2:175148536-175148558 AAACTAGTTAAGGCCATGATGGG + Intronic
942779011 2:179618653-179618675 CAAGAAGTTCAGGCAGTGACAGG - Intronic
942945388 2:181666593-181666615 AAACTAGTTCATGCCATGATGGG + Intronic
943309244 2:186306533-186306555 AAACTAGTTGAGGCCATGATGGG + Intergenic
943657240 2:190522560-190522582 AAATTGGTTCAGGCTATGCCAGG + Intronic
943877451 2:193089379-193089401 AAACTAGTTAAGGCCATGACAGG - Intergenic
944185420 2:196942694-196942716 AAACCACTTCATCCTGTGACAGG + Intergenic
944301328 2:198128221-198128243 AAGCTAGTTCAGGCCATGATGGG + Intronic
945001161 2:205352456-205352478 AAATTATTTCATTCTGTGACTGG - Intronic
945811336 2:214553755-214553777 AAACTAGTTCAGGCTGTGATGGG - Intronic
947226139 2:227842235-227842257 AAGCTATTTCAGGCTATGAGGGG - Intergenic
947267475 2:228299617-228299639 AAACTAGTTCAGGCCATGATGGG - Intergenic
947618175 2:231571887-231571909 AAACTAGTTCAGGCCATGATGGG - Intergenic
947814660 2:233028361-233028383 AAACTAGTTCAGACCATGATGGG + Intergenic
947949714 2:234136562-234136584 AAACTAGTTCAGGCCATGATGGG + Intergenic
947996307 2:234530594-234530616 AAACTAGTTCAGGTCATGATGGG + Intergenic
948437430 2:237963159-237963181 AAATTAGTTCAGGCCATGATGGG + Intergenic
948633140 2:239314884-239314906 AAGCTAGTTCAGGTCGTGATGGG + Intronic
948717971 2:239877878-239877900 AAATTAGTTCAGGCTGTGGTGGG - Intergenic
949038856 2:241835530-241835552 AAACTAGTTCAGGCTGGGTGCGG - Intergenic
1169302809 20:4459242-4459264 AAACTAGTTCAGACCATGATGGG + Intergenic
1169631528 20:7637970-7637992 ATACTGGTTCAGTCTGTGACAGG + Intergenic
1170823764 20:19776155-19776177 AAACTAGCTCAGGCCATGATGGG + Intergenic
1170936677 20:20816235-20816257 AAACAAGTTCAGGCCATGATGGG - Intergenic
1172566958 20:35938250-35938272 ACACTAGTTCAGGCCATGATGGG - Intronic
1173746504 20:45441498-45441520 AAACTAGTTCAGGCCATGATGGG - Intergenic
1173887958 20:46478615-46478637 AAACTAGTTCAGGCCATGATGGG - Intergenic
1174144637 20:48443206-48443228 AAAAAATATCAGGCTGTGACAGG + Intergenic
1174323414 20:49760254-49760276 AAACTAGTTCAGGCCATGATGGG + Intergenic
1174868536 20:54161971-54161993 ATACTAGTTCGAGCTGTGATGGG - Intronic
1175879216 20:62247084-62247106 GAACTAGGTCAGGCTGGGGCCGG - Intronic
1176071470 20:63228921-63228943 AAACAAGTTCAGCCCATGACAGG - Intergenic
1176362887 21:6012987-6013009 AAACTAGTTCAGGCCGTGATGGG - Intergenic
1176363700 21:6019786-6019808 AAACAAGTTCAGGCCATGATGGG - Intergenic
1176740142 21:10594273-10594295 AGACTACTTCAGGCTGAGAAGGG - Intronic
1176902500 21:14460402-14460424 AAACTAGTTCAGGCCGTGATAGG + Intergenic
1177013851 21:15759770-15759792 AGACTGGTTCAGGCCATGACTGG - Intronic
1177173764 21:17682016-17682038 AAACTAGTTCAGGCCACGATGGG - Intergenic
1177191844 21:17860882-17860904 AAACTAGTTCAGGCCATGACGGG - Intergenic
1177507725 21:22040133-22040155 AAACTAGAAAAGGCTTTGACTGG - Intergenic
1177801720 21:25834563-25834585 AAACTAGTACAGGCCGTGATGGG + Intergenic
1178094517 21:29199156-29199178 AAACTAGTTCAGGCCATGATGGG + Intronic
1178247518 21:30968308-30968330 AATCTAGTTCAGGCCATGATGGG - Intergenic
1178516722 21:33254203-33254225 ACACTAGTTCAGGCCATGATGGG + Intronic
1178866216 21:36329647-36329669 AGACTAGTTCAGGCCATGACAGG + Intronic
1178897391 21:36570402-36570424 AAACTAGTTCAGGTCATGATGGG - Intronic
1179169954 21:38965228-38965250 AATCTAGTTCAGGCCAGGACGGG + Intergenic
1179345428 21:40551867-40551889 AAGGTAGTTCAGGCCATGACAGG - Intronic
1179564138 21:42235839-42235861 AGACTGGTTCAGGCCATGACGGG - Intronic
1179620008 21:42607890-42607912 AAGCTAGTTCAGGCTGTGATGGG + Intergenic
1179759818 21:43518759-43518781 AAACAAGTTCAGGCCATGATGGG + Intergenic
1179760631 21:43525558-43525580 AAACTAGTTCAGGCCGTGATGGG + Intergenic
1180094155 21:45547357-45547379 AAACTGGTTCAGGCCATGAGGGG + Intergenic
1180866764 22:19124234-19124256 AAACTATTTCAGGCCGTGATAGG - Intergenic
1182880301 22:33727250-33727272 AAACCAGCTCAGGCTGTTACTGG - Intronic
949462609 3:4309302-4309324 AAACTAGTTCAGGTCATGATGGG - Intronic
949927596 3:9054200-9054222 AAACTAGTTCAGGCCATGATGGG + Intronic
950111193 3:10419794-10419816 CAACTAGATCAGGCTGGAACAGG - Intronic
950917367 3:16659569-16659591 AAACTAGTTCAGGCCATGGTAGG + Intronic
951000685 3:17555887-17555909 AAACTTGCTCAGGCCATGACAGG - Intronic
951773804 3:26286462-26286484 AAACTAGTTCAGGCCATGGTGGG + Intergenic
951857447 3:27213599-27213621 AAACTAGTTCAGGCCGTGATAGG + Intronic
952033803 3:29175886-29175908 ACACTAGTTCAGGCCATGATGGG - Intergenic
952666033 3:35905476-35905498 AAACTAGTTCAGGCCCTGATGGG - Intergenic
953167242 3:40476407-40476429 AATCTAGTTCAGGCCATGATGGG - Intergenic
953454038 3:43028321-43028343 AAACTGGTTCAGGCCATGATGGG - Intronic
953505400 3:43481483-43481505 AAACTAGTTCAGGCCATGATGGG + Intronic
954923511 3:54212652-54212674 AAACTAATTCAGGCCATGATAGG - Intronic
955909772 3:63847909-63847931 AAACTAGTTTAGGCCATGATGGG + Intronic
956370041 3:68549444-68549466 AAACAACTTGGGGCTGTGACTGG - Intergenic
956716069 3:72081168-72081190 AAACTAGTTCAGGCCATGATGGG - Intergenic
957165062 3:76662114-76662136 AAACTAGTTCAGGCCATGATGGG - Intronic
957412347 3:79858195-79858217 AAACTAACTCAGCCTGTGATGGG - Intergenic
957483911 3:80832998-80833020 AAACTAGTTCAGGCCGTGATGGG + Intergenic
957653546 3:83039733-83039755 ACACTACTTCAGGCCATGACAGG + Intergenic
957773743 3:84728761-84728783 ACACTAGTTCAGGCCATGATGGG + Intergenic
957965238 3:87313620-87313642 AAATTAGTTCAGGCTGTGATGGG - Intergenic
959053044 3:101542605-101542627 AAACTAGTTCAGGCCATGATGGG - Intergenic
959608240 3:108265508-108265530 AAACTAGTTCTGGGTGTAAACGG - Intergenic
959803934 3:110528535-110528557 AACCCAGTTCAGGCCGTGATGGG - Intergenic
959809476 3:110598595-110598617 AAACTACTTCAGGCCATGATGGG + Intergenic
960390649 3:117073706-117073728 AAAATAGTTCAGGTGGTGCCAGG + Intronic
960410235 3:117314178-117314200 AAACTAGTTCAGGCCATGATGGG + Intergenic
960434689 3:117611379-117611401 AAGCTAGTTCAGGCTTTGCTAGG - Intergenic
960482870 3:118214601-118214623 AAATTAATTCTGGCTGTGAAAGG + Intergenic
961313813 3:126020620-126020642 AGACTGGTTCAGGCCATGACGGG + Intronic
961323087 3:126091968-126091990 AAAGTAGTTCAGGCCATGATGGG - Intronic
961470864 3:127111108-127111130 AACCTAGTTCAGGCCATGATGGG + Intergenic
961957435 3:130818513-130818535 AAACTAGTTCAGGCCATGATGGG + Intergenic
962040902 3:131706565-131706587 AAACTAGTTTAGGCTATGATAGG + Intronic
962182840 3:133226614-133226636 AAACTAGCTCAGGCCATGATGGG - Intronic
963756454 3:149239580-149239602 AAACTAATTCAGGCCATGATGGG - Intergenic
963842180 3:150119035-150119057 AAGCTAGTTCAGGCCATGAGGGG + Intergenic
964260366 3:154828599-154828621 AAACAAGTTCAGGCCATGATGGG - Intergenic
964856114 3:161147680-161147702 AAACTAGTTCACGCCATGATGGG - Intronic
965273242 3:166646535-166646557 AAACTAATTCAGGCTATGATGGG - Intergenic
965278221 3:166715529-166715551 ACACTAGTTCAGGCCATGATGGG + Intergenic
966227195 3:177610562-177610584 GAACTAGTTCAGGTTGTGACAGG - Intergenic
967543248 3:190693568-190693590 AAACTAGTCCAGGCCATGATGGG + Intergenic
967925460 3:194642204-194642226 AAAGGAGTCCAGGCTGTGATGGG - Exonic
968363193 3:198163443-198163465 AGACTGGTTCAGGCTATGATGGG - Intergenic
969198966 4:5586470-5586492 AAACCAGTTCAGGCCATGAAGGG + Intronic
969272444 4:6111998-6112020 AAGCTAGTTCAGGCCATGATGGG + Intronic
969346318 4:6572571-6572593 AAACTAGTTCAGGCCATGATGGG + Intergenic
969566259 4:7980182-7980204 AACCTAGTTCAGGCCATGAAGGG + Intronic
969634354 4:8357925-8357947 AAACCAGTTCAGGCCATGAATGG + Intergenic
969661525 4:8532439-8532461 AAACCAGTTCAGGCCGTGATGGG - Intergenic
970205679 4:13653514-13653536 AAACTGGTTCAGGCCATGACGGG + Intergenic
970244057 4:14040226-14040248 AATCTAGTTCAGGCCATGATGGG - Intergenic
971250800 4:24971713-24971735 AAACTAGTTCAGCCCATGATGGG + Intronic
971277228 4:25209878-25209900 AAACTAGTTCAGCCCATGATGGG - Intronic
971689216 4:29811362-29811384 ACACTAGTTCAGGCCATGATGGG - Intergenic
971998083 4:33993334-33993356 AAACTAGTTGAGGCCATGATGGG - Intergenic
972303224 4:37805955-37805977 AGACTGGTTCAGGCCGTGATGGG + Intergenic
972322865 4:37988817-37988839 AAACTCGTTCAGGTCGTGATGGG + Intronic
973253135 4:48082251-48082273 AAACTAGTTCAGGCCACGATGGG + Intronic
973336882 4:48965621-48965643 AAACTAGTTCAGGCCATGATGGG + Intergenic
973975281 4:56256856-56256878 AAACTAGTTCAGGCCATTATGGG + Intronic
974772816 4:66437616-66437638 AAACTAGTTCAGGCCAGGACAGG + Intergenic
974935233 4:68403618-68403640 ACACTAGTTCAAGCCATGACGGG + Intergenic
975066063 4:70064858-70064880 AAACTAGTTCAGGCCATGATGGG - Intergenic
975188043 4:71426249-71426271 AAACTAGTTCAGACCATGATGGG - Intronic
975222404 4:71828154-71828176 AAACTAGTTGAGGCCATGATGGG - Intergenic
975240352 4:72050372-72050394 AAACTAGTTCAGTCTGTGATGGG + Intronic
975485003 4:74926212-74926234 AAACTAGTTCAGGCCATGATGGG - Intergenic
975797647 4:78025920-78025942 AAACTAGTTTAGGCCATGATGGG - Intergenic
976008747 4:80461610-80461632 AAACTAGTTCAGGCCATAATGGG - Intronic
976696035 4:87920591-87920613 AAACTAGTTCAGACTATGATGGG + Intergenic
977578205 4:98697093-98697115 AAACTAGTTCAGGCCATGACAGG + Intergenic
977610562 4:99025697-99025719 AGACTGGTTCAGGCCATGACTGG + Intronic
977836812 4:101654996-101655018 AAACTACTTCTGGTTGCGACAGG + Intronic
978423037 4:108554202-108554224 AGACTGGTTCAGGCCATGACGGG + Intergenic
978551170 4:109928868-109928890 AAACTAGTTCAGGCCATGATGGG - Intronic
980259811 4:130433600-130433622 AAACTAGTTCAGGCCATGATGGG + Intergenic
980279424 4:130700188-130700210 AAACTAGTTCAGTCCATGATGGG - Intergenic
980346013 4:131620793-131620815 TAACTAGTTCAGGCTGGGCATGG + Intergenic
980777109 4:137451766-137451788 AAACTAGTTCAGGCCATAGCAGG - Intergenic
980908701 4:138974572-138974594 AAACTAATTCAGGCTATGGTGGG + Intergenic
980982862 4:139669137-139669159 AAACGAGTTCAGGCCATGATGGG - Intronic
981077582 4:140606629-140606651 AAACGAGTTCAGGCCTTGATGGG + Intergenic
981091911 4:140741018-140741040 AAACTAGTTCAGGCCATGGTAGG + Intronic
981092302 4:140744360-140744382 AAACTAGTTCAGGCCATGATGGG + Intronic
981309026 4:143277984-143278006 AATCTAGTGCAAGCTATGACTGG + Intergenic
981312320 4:143309291-143309313 GAACTAGTTCAGGCCATGACGGG - Intergenic
981524734 4:145698684-145698706 AAACTAGTTCAGGGCATGATGGG - Intronic
982009551 4:151093435-151093457 ACACTAGTTCAGGCCATGATGGG - Intergenic
982270153 4:153578082-153578104 CAAGTGGTTCAGGCTGTAACAGG + Intronic
982334927 4:154224545-154224567 TAACTAGTTCAGGCCATGATAGG + Intergenic
982449316 4:155533195-155533217 AAACTGGTTCAGGCCATGACAGG + Intergenic
983024414 4:162715445-162715467 AAACTAGTTCAAGCCATGATGGG + Intergenic
983710769 4:170712926-170712948 AGACTGGTTCAGGCCATGACGGG + Intergenic
984008285 4:174340053-174340075 AAACTAGTTCAGGCCATGATGGG - Intergenic
984291222 4:177797042-177797064 AAACTACTTCAAGCTGTGCTTGG + Intronic
984869287 4:184312401-184312423 AAACTAGTTCAGGTCATGAGGGG + Intergenic
985232391 4:187834659-187834681 TAACTAGTTCAGTCTTTCACTGG - Intergenic
985482962 5:128886-128908 GAACGAGTTCAGGCCGTGACAGG + Intergenic
985614620 5:912130-912152 AAACTAGTTTTGTATGTGACAGG + Intronic
986689476 5:10302334-10302356 AAACTAATTCAGGCCATGACAGG + Intronic
986748225 5:10761923-10761945 AAACTAGTTCAGGCCTTGATGGG + Intergenic
987144890 5:14982504-14982526 AAACTAGTTGAGGCCATGACAGG - Intergenic
987144966 5:14982946-14982968 AAACTAGTTTGGGCCATGACAGG + Intergenic
987265827 5:16254052-16254074 AAACTAGTTCAGGCCATGATGGG - Intergenic
987586118 5:19859176-19859198 AAACTAGTTCAGGCCATGATGGG + Intronic
987908218 5:24106442-24106464 ACACTAGTTCAGGCCATGATGGG + Intronic
987965266 5:24864610-24864632 ACACTAGTTCAGGCCATGATAGG - Intergenic
988505133 5:31815648-31815670 AAACTGGTTCAGGCCATGACAGG - Intronic
988603263 5:32658542-32658564 AAACCATCTCAGGCTGTGATTGG + Intergenic
988637756 5:33005475-33005497 AAACAAGTTAAGGCCATGACGGG + Intergenic
988927445 5:36003903-36003925 AAACTGGTTCAGGCTATGACAGG + Intergenic
989183370 5:38599882-38599904 AAACTAGTTCAGGCCATGATGGG + Intronic
990123063 5:52479877-52479899 CAACTAGTTCAGGCCATGGCAGG + Intergenic
990614212 5:57490550-57490572 AAACTAGTTCAGGCCATTATAGG - Intergenic
990737350 5:58878729-58878751 AAACTAGTGCAGGCTGGGCATGG + Intergenic
991447488 5:66715710-66715732 AGACTGGTTCAGGCCATGACAGG + Intronic
991773023 5:70057534-70057556 AAACTAGTTCAAGCCATGATGGG + Intronic
991852316 5:70932958-70932980 AAACTAGTTCAAGCCATGATGGG + Intronic
992110486 5:73488065-73488087 AAACTAGTTCAGGCCATGATGGG - Intergenic
992164794 5:74038773-74038795 GAACAAGTTCAGGCTATGATGGG + Intergenic
992193021 5:74312661-74312683 AAACTAGCTCAGGCCATGATGGG + Intergenic
992306925 5:75450231-75450253 AAACTAGTTCAGACCATGACTGG + Intronic
992583659 5:78209192-78209214 AAACTAGTTCAGACCATGATAGG + Intronic
992802328 5:80304718-80304740 AAACTATTTCAGGCCGTGATGGG - Intergenic
992910293 5:81389815-81389837 AAACTAATACAGGCTGGGCCTGG - Intronic
992930066 5:81634072-81634094 AGACTGGTTCAGGCCATGACAGG + Intronic
993659121 5:90608650-90608672 AAGCTTTCTCAGGCTGTGACTGG + Intronic
994198506 5:96945714-96945736 AAACTAGCTCAGGCTATGATGGG - Intronic
994829362 5:104759362-104759384 AAACTAGTTCAGGCCATGATGGG + Intergenic
994859246 5:105167286-105167308 AAACTAGTTCAGGCCATGATGGG + Intergenic
995035609 5:107530818-107530840 ATACTGTTTCATGCTGTGACTGG + Intronic
995083471 5:108081251-108081273 AATCTAATTCAGGCTGTTATGGG - Intronic
995123978 5:108561894-108561916 AAACTAGTTCAGGTCATTACAGG + Intergenic
995127908 5:108598183-108598205 AAACTAGTTCAGGCCATGATGGG - Intergenic
995454128 5:112334008-112334030 AAACTAGTTCAGGCCATGATGGG + Intronic
995507661 5:112876669-112876691 AAACTAATTGAGCCTGTGCCTGG - Exonic
995577066 5:113548889-113548911 AAACTAGTTCATGATGAGCCTGG - Intronic
996573988 5:124962523-124962545 AAAGAAGCTCAGGCTGTGTCAGG - Intergenic
996688724 5:126313990-126314012 AAAGTAGTTCAGGCCATGATGGG - Intergenic
997222963 5:132184447-132184469 AAACTATATCACACTGTGACTGG + Intergenic
997258156 5:132445007-132445029 AAACTAGTTTAGGCCATGATGGG - Intronic
998773358 5:145571307-145571329 AAATGAGTTCAGGCTAGGACAGG + Intronic
999668806 5:153940305-153940327 AGACTGGTTCAGGCCATGACAGG + Intergenic
999738355 5:154530095-154530117 TAACTATTTCAGGCTTTGAGGGG - Intergenic
999801735 5:155044772-155044794 AAACTAGTTCAGGCCATGCTGGG + Intergenic
1000087024 5:157896548-157896570 AAACTAGTACAGGTGGTGATGGG + Intergenic
1000481811 5:161785963-161785985 AAACTAGTTCAGGCCATAATGGG - Intergenic
1000601037 5:163274715-163274737 AAACTAGTTCAGGCCATGATGGG - Intergenic
1000657116 5:163892936-163892958 AAACTAGTTCAGGCCATGTTGGG + Intergenic
1000718878 5:164681095-164681117 AAATTAGTTCAGGCCATGACGGG - Intergenic
1001282503 5:170397160-170397182 AAACTAGTTCAGGCCATAATGGG - Intronic
1002410260 5:179069154-179069176 AGACTGGTTCAGGCCGTGACAGG + Intronic
1002652639 5:180712681-180712703 AAACTAGTTCAGGCCATGATGGG + Intergenic
1003067208 6:2913943-2913965 AAACTAGTTCAGGCCATGATGGG - Intergenic
1003196355 6:3918671-3918693 ACACTAGTTCAGGCCATGATGGG - Intergenic
1004200873 6:13546752-13546774 AAACTAGTTGAGGCCATGACAGG + Intergenic
1005363275 6:25053001-25053023 AAACTAGTTCAGGCCATGATGGG - Intergenic
1006679077 6:35784434-35784456 AGACTGGTTCAGGCCATGACGGG - Intronic
1008061585 6:47003128-47003150 AAACTAGTTGAGGTTATGATGGG + Intronic
1008476014 6:51936668-51936690 AAACTAGTTCAGGCCATGACGGG + Intronic
1008730259 6:54473533-54473555 AAACTGGTTCAGGCCATGAAAGG + Intergenic
1009346404 6:62617129-62617151 AAGCTAGTTCAGGCCGTGATGGG + Intergenic
1009737199 6:67691183-67691205 AAACTAGTTCAGGCCGTGATGGG + Intergenic
1011400469 6:86955950-86955972 AAACTAGTTCAGGCCATGATGGG + Intronic
1012118143 6:95330956-95330978 AAACTAGTTCAGGCCATGATGGG - Intergenic
1012227199 6:96717846-96717868 AAACCAGTTCAGGCCATGATGGG + Intergenic
1012573838 6:100765304-100765326 AAACTAGTTCAGGCCATGATGGG + Intronic
1012759653 6:103282670-103282692 AAACTAGTTGAGGCCATGACAGG + Intergenic
1013088990 6:106882354-106882376 AAACTAGTTTAGGCCATGATGGG - Intergenic
1013243610 6:108268247-108268269 AAACTAGTGCAGGCCATGACAGG - Intergenic
1013607338 6:111762407-111762429 AAACTAGTTCAGGCCATGAAGGG + Intronic
1014242696 6:119035262-119035284 AAACTAGTTCAGGCTATGATAGG + Intronic
1014252379 6:119128005-119128027 ACACTAGTTCAGGCCATGACTGG + Intronic
1014315903 6:119864292-119864314 AAACAAGTTCAGGCCATGAAAGG + Intergenic
1014615077 6:123588435-123588457 AAACTAGTTCAGGCCATGATGGG - Intronic
1015167117 6:130210706-130210728 AAACTAATTCAGGCCATGATGGG + Intronic
1015332963 6:132003031-132003053 AAACTAGTTTAGGCCATGATGGG - Intergenic
1015704164 6:136069075-136069097 ACACTAGTTCAGGCTATGAGGGG - Intronic
1015751920 6:136568982-136569004 AAACTAGTTCAGGCCATTATGGG + Intronic
1015814382 6:137193001-137193023 AAACTAGTTCAGGCCATGATGGG - Intergenic
1015879785 6:137860136-137860158 ATACTAGTTCAGGCCATGATGGG + Intergenic
1016374109 6:143403024-143403046 AAACTAGTTCAGGCCATGATGGG - Intergenic
1016490751 6:144598816-144598838 ACACTAGTTCAGGCCGTGATGGG - Intronic
1016521481 6:144951516-144951538 AAACTAGTTCAGGCCATGACTGG + Intergenic
1016681332 6:146832882-146832904 AAACTAATTCAGGCTATGACAGG - Intergenic
1016920700 6:149290179-149290201 AAACTAGTTCAGGCCATGGTGGG - Intronic
1017576479 6:155810641-155810663 AAACTGGTTCAGGCAATGATGGG - Intergenic
1017837028 6:158187949-158187971 AAACTAGTTCAGGCCATGATGGG - Intronic
1017868422 6:158465146-158465168 AAACTAGTTCAGGCTGTGACAGG - Intronic
1018138978 6:160807693-160807715 AGACTGGTTCAGGCCATGACAGG + Intergenic
1018595697 6:165478383-165478405 AATCTAGTTCAGGCAATGATGGG + Intronic
1018866478 6:167750535-167750557 AAGCTGGTTCAGGCTGTGATGGG + Intergenic
1018991845 6:168679721-168679743 AAACTAGTTCAGGCTTTGATGGG + Intergenic
1019046075 6:169147115-169147137 AAACTAGTTCAGGCCATGATGGG + Intergenic
1019150064 6:169999563-169999585 AAATTCCTTCAGGCCGTGACAGG + Intergenic
1019233154 6:170585212-170585234 AAACTAGTTCAGGCAATGATGGG - Intergenic
1019252487 7:25268-25290 AGACTGGTTCAGGCTATGATGGG + Intergenic
1019946849 7:4336800-4336822 AAACTGGTTCAGGCCTTGATAGG - Intergenic
1020363180 7:7351886-7351908 AAACTAGTTCAGGCCATCATGGG + Intergenic
1021641748 7:22744404-22744426 AAACTAGTTCAGGCCATGGCAGG - Intergenic
1022732609 7:33044221-33044243 AAACTATATCAGGCTGTCTCTGG + Intronic
1022985459 7:35649912-35649934 AAACTGGTTCAGGCCATGATGGG - Intronic
1023308656 7:38858458-38858480 AAACTAGTTCAGGCCATGACGGG - Intronic
1023392121 7:39720696-39720718 AAACTAGTTTAGGCCATGACAGG - Intergenic
1023411575 7:39893671-39893693 AAACTGGTTCAGGCCATGACAGG + Intergenic
1023932434 7:44713967-44713989 AAATTAGTTCAGCCTATGCCCGG - Intergenic
1024122091 7:46253716-46253738 AAACTAGTTCAGGCCATGATGGG + Intergenic
1024148624 7:46543693-46543715 AAATTAGTTCAGGCCATGAAAGG + Intergenic
1024211680 7:47211530-47211552 AAACTAGTTCAGGCCATGATGGG - Intergenic
1024276328 7:47679973-47679995 AGACTGGTTCAGGCCATGACGGG + Intergenic
1024716528 7:52085814-52085836 AAACTAGTTCAGGTCATGACAGG - Intergenic
1024846186 7:53645083-53645105 AAACTAGTTCAGGACATGATGGG - Intergenic
1025033598 7:55576592-55576614 AAACTAGTTCAGGCAATGATGGG - Intergenic
1025164563 7:56701478-56701500 AAACTAGTTCAAGCCATGAAGGG + Intergenic
1026119198 7:67521846-67521868 AAACTAGTTCAGGCTATTATGGG + Intergenic
1026210118 7:68296609-68296631 AAACTAGTTCAGGACATGATGGG - Intergenic
1026247432 7:68633713-68633735 AAACTAGTTCAGGCCATGGTGGG - Intergenic
1026501281 7:70945224-70945246 AACCTAGTTCAGGCCATGATGGG + Intergenic
1026563038 7:71466253-71466275 AAACTAGTTCAGACCATGACTGG + Intronic
1027519599 7:79188827-79188849 ATACTAGTAATGGCTGTGACAGG - Intronic
1027616624 7:80431906-80431928 AAACTAGTTCAGGCCATGATGGG - Intronic
1027620674 7:80481348-80481370 AAACTAGGTCAGGCTGTGATAGG + Intronic
1028149151 7:87352120-87352142 AAACTAATTCAGGCCATGAGGGG - Intronic
1028389443 7:90297300-90297322 AAACTAGTTCAGGCCATGATGGG - Intronic
1028689589 7:93636678-93636700 AAACTAGTTCAGGCCATGATGGG - Intronic
1028716424 7:93976290-93976312 AAAGTAGTTCTGGATGTGAAGGG - Intronic
1029354516 7:100041930-100041952 AAACTAGTTCAGGCCATGATGGG + Intergenic
1029500970 7:100929686-100929708 AAACTAGTTCAGGCCATGATGGG - Intergenic
1029616245 7:101659923-101659945 ACACTAGTTCAGGCTGTGATGGG - Intergenic
1030185317 7:106755939-106755961 AAACTAGCTCAGGCTGTAATGGG - Intergenic
1030190857 7:106808847-106808869 AGACTGGTTCAGGCCATGACAGG - Intergenic
1030282294 7:107789535-107789557 AAACTGGATCAGTGTGTGACGGG + Exonic
1030985089 7:116231853-116231875 AAACTAGTTCAGGCCATGATAGG - Intronic
1031188834 7:118519814-118519836 AAACTAGTTCAGGTGATGATGGG - Intergenic
1032674255 7:134113834-134113856 AAACTAGTTCAGGCCATGATGGG + Intergenic
1033175805 7:139122668-139122690 AAACTAGTTCAGGCCATGATGGG - Intergenic
1033627037 7:143120426-143120448 AAATTAGTTCAGGCCATGATGGG - Intergenic
1033801296 7:144905539-144905561 AAACTAGTTCAGGCCATGACGGG - Intergenic
1034060144 7:148079861-148079883 AAACTAGTTCAGGTCATGATGGG - Intronic
1034223870 7:149467503-149467525 AAACTAGTTCAGGCCATGATGGG - Intergenic
1035359963 7:158305144-158305166 ACACTAGTTCAGGCCATGATGGG - Intronic
1035476493 7:159147871-159147893 AAACGAGTTCAGGCCATGACAGG + Intergenic
1035550163 8:517043-517065 AAACTAGTTCAGGCCGTGATGGG + Intronic
1035556866 8:573628-573650 AAACGAGTTCAGGCCATGATGGG - Intergenic
1035716488 8:1759202-1759224 AGACTAGTTCAGACCGTGATGGG - Intronic
1035952060 8:4032867-4032889 AAACTAGGTCAGGCCGTGGTGGG + Intronic
1036057910 8:5280325-5280347 AAACTAGTTCAGGCCATGATGGG + Intergenic
1037209692 8:16371500-16371522 AAACTAGTTCTGGCCATGATGGG - Intronic
1037331668 8:17749075-17749097 AAACTAGTTCAGGATATGAAAGG + Intronic
1037598845 8:20376594-20376616 AAACTAGTTCAGGCCATGATGGG + Intergenic
1037653307 8:20860605-20860627 AAAGTAGTTCAGGCCATGACAGG + Intergenic
1037800220 8:22029676-22029698 AAACTTATTCAGGCTTTGTCTGG + Intronic
1038506758 8:28091346-28091368 AAACTAGCTCAGGCCATGATGGG - Intronic
1038739514 8:30204631-30204653 AAACTAGTTCAGGCCTTGATGGG - Intergenic
1038905454 8:31897203-31897225 AAACTAGTTCAGGCCATGATAGG + Intronic
1039264211 8:35807322-35807344 AAATTAGTTCAGGCTATGATCGG - Intergenic
1039501407 8:38020581-38020603 AAACTAGTTCAGGCTATGAAGGG - Intergenic
1039685296 8:39795275-39795297 AAACAAGTTCAGGCCATGATGGG + Intronic
1039736492 8:40338239-40338261 AAATTAGTTCAGGCCATGACAGG - Intergenic
1040417576 8:47208681-47208703 AAACGAGTTCAGGCCATGATGGG + Intergenic
1040621021 8:49092886-49092908 AGACTGGTTCAGGCCATGACAGG + Intergenic
1041000400 8:53443982-53444004 AAACTAGTTCAGGCCATGCTGGG + Intergenic
1041253781 8:55961199-55961221 ACTCTAATTCCGGCTGTGACTGG - Intronic
1042184441 8:66122686-66122708 AAACTAGTTCAGGCCATTATGGG + Intergenic
1042199882 8:66271119-66271141 AAACTAATTCAGGCCATGATGGG - Intergenic
1042933479 8:74035559-74035581 AAACTGGTTCAGGCAATGACAGG + Intergenic
1042979022 8:74505114-74505136 AGACTAGTTCAGGCCATGATGGG + Intergenic
1043413110 8:80020342-80020364 AAACTAGTGCAGGCCGTGATGGG - Intronic
1043608124 8:82027594-82027616 AAACTAGTGCATGCCATGACAGG + Intergenic
1043624045 8:82232589-82232611 AAACTAGTTCAGGCCATGATGGG + Intergenic
1043740742 8:83808401-83808423 AGACTAGTTCAGGCCATGACAGG + Intergenic
1044083070 8:87908731-87908753 AAACTAGTTCAGGCCATGATGGG + Intergenic
1044188184 8:89281572-89281594 AAACTAGTTCAGGCCAGGACAGG + Intergenic
1044211970 8:89561120-89561142 AAGCTAGTTCAGGCCATGATGGG - Intergenic
1044396582 8:91720458-91720480 AAACTAGTTCAGTCCATGATGGG - Intergenic
1044723819 8:95175978-95176000 AAACTAGCTCAGGCCATGATGGG + Intergenic
1045126035 8:99090056-99090078 AAACTACTTCAGGCTATGATGGG - Intronic
1045253081 8:100497472-100497494 AAACTAGTTCAGGCCATGATGGG - Intergenic
1045290834 8:100831310-100831332 AAACTAGTTAAGGCCATGATGGG - Intergenic
1046867387 8:119165499-119165521 GAATTAGTTCAGGCTACGACAGG - Intronic
1047544832 8:125805352-125805374 AAACTAGTTCAGGCCATGATGGG + Intergenic
1048621454 8:136137354-136137376 AAACAAGTTGAGGCTCTGATGGG + Intergenic
1048656763 8:136547070-136547092 AAACTATTTGAGGCTCTGAGTGG + Intergenic
1048677962 8:136805960-136805982 AGACTGGTTCAGGCCATGACAGG - Intergenic
1048891755 8:138954515-138954537 AGACTGTTTCAGGCTATGACAGG + Intergenic
1049870197 8:144968942-144968964 AAACTAGTTCAGTCCATAACAGG + Intergenic
1049959841 9:727934-727956 AAACTAGTTCAGGCCATGATGGG + Intronic
1050989847 9:12136868-12136890 AAACTAGTTCAGACAGTGATGGG + Intergenic
1054711075 9:68511376-68511398 AAACTAGTTCAGGCCATAACAGG - Intronic
1054831094 9:69625619-69625641 AAACTAATTGAGTCTGTGAGTGG - Intronic
1055233603 9:74091736-74091758 AAACTAGTTCAGGCCATGATGGG + Intergenic
1055708660 9:79035568-79035590 AGACTGGTTCAGGCCATGACAGG - Intergenic
1055776871 9:79775832-79775854 AAACTAGCTCAGGCCATGTCAGG - Intergenic
1055804813 9:80080979-80081001 AATCTAGTTGGGGCTGTGAAGGG + Intergenic
1056070891 9:82985489-82985511 AAACCATATCAGGCTGTGATGGG + Intronic
1056600786 9:88045180-88045202 AAACTAGTTCAGGTCATGACAGG + Intergenic
1056681989 9:88727420-88727442 AAACTGGTTTAGGCCATGACGGG - Intergenic
1056715583 9:89025572-89025594 AAACTAGGTCAGGCCATGATGGG + Intronic
1056723027 9:89087754-89087776 AAACTAGTTCAGGTCCTGATGGG + Intronic
1056775280 9:89507824-89507846 AGACTGGTTCAGGCTGGGACAGG - Intergenic
1056868402 9:90253086-90253108 AAACTAGTTCAGGTCATGATGGG + Intergenic
1056902097 9:90609383-90609405 AAACTAGTTCAGGCCATGATGGG - Intergenic
1056995337 9:91452065-91452087 AAACTAGTTTAGGCTGTGATGGG + Intergenic
1057382499 9:94581768-94581790 AAACAAGTTCAGGCCATGGCAGG + Intronic
1057943921 9:99308105-99308127 AAACTAGTTCAGGCCATGACGGG + Intergenic
1057981557 9:99669112-99669134 AAGCTAGTTCAGGCCATGACAGG - Intergenic
1058075014 9:100642125-100642147 ATACTAGTGCAGGGAGTGACTGG - Intergenic
1058301073 9:103373662-103373684 AAACTAGTTGAGGCCATGATGGG + Intergenic
1059752318 9:117259384-117259406 AAACTAGTTCAGGCCATGATGGG + Intronic
1059881567 9:118696009-118696031 AAACTATATCAGGTTGTAACAGG + Intergenic
1060057443 9:120426969-120426991 AAACTAGTTCAGACCATGATGGG - Intronic
1061031163 9:128084162-128084184 AAACTAATTCAGGCCATGATGGG + Intronic
1061675125 9:132211254-132211276 GACCTAGTTCAGGCTGAGAGTGG - Intronic
1062747880 9:138227103-138227125 AGACTGGTTCAGGCTATGATGGG - Intergenic
1185662523 X:1738645-1738667 AAGCTAGTTCAGGCCATGACAGG - Intergenic
1185788547 X:2911079-2911101 AAACTAGGTCAGGCCGGGCCTGG + Intronic
1185817363 X:3168778-3168800 AAACTGGTTCAGGCGATGGCGGG - Intergenic
1185839602 X:3376317-3376339 AAACTGGTTCAGGCCATGATGGG + Intergenic
1185975918 X:4719860-4719882 AAACTAGTTCAGGCCATGACTGG + Intergenic
1186340789 X:8644291-8644313 AAATTAGTTCAAGCCATGACAGG + Intronic
1186428710 X:9486007-9486029 AAACTGGTTCAGGGCATGACAGG + Intronic
1186718310 X:12276691-12276713 AAACTACTTCAGGCCATGATGGG - Intronic
1186811912 X:13198619-13198641 AAACTAGTTCAGGCCATGATGGG + Intergenic
1186820542 X:13283612-13283634 AAACCAGTTCAGGCCGTGATGGG - Intergenic
1186873295 X:13793001-13793023 AAACTAGTTCAGGCCATGATTGG + Intronic
1187013085 X:15299644-15299666 AAACTGGTTCAGGCCATGACAGG - Intronic
1187057434 X:15754133-15754155 GAACTAGTTCAGGCCATGAGGGG - Intronic
1187124943 X:16446191-16446213 AAACTAGTTCAGGCAATGATGGG + Intergenic
1187138687 X:16572540-16572562 TAATTAGTTCAGACTGTCACAGG - Intergenic
1188192363 X:27187793-27187815 AGACTGGTTCAGGCCATGACTGG + Intergenic
1188839103 X:34992971-34992993 AAACTAGCTCAGGCCATGATGGG - Intergenic
1188876217 X:35433606-35433628 AAACTAGTTCAGGCCATGATGGG - Intergenic
1188902748 X:35754078-35754100 GAACTAGTTCAGGCCATGATAGG - Intergenic
1188908988 X:35822602-35822624 AGACTAGTTCAGGCCATGACAGG + Intergenic
1188937817 X:36198794-36198816 AAACTAGTTCAAGCCATGACAGG - Intergenic
1189176215 X:38959949-38959971 AAACTAGTTCAGGCCATGATGGG - Intergenic
1189748297 X:44192961-44192983 AAACTAGTTCAAGCCATGATGGG + Intronic
1189957415 X:46289349-46289371 AAACTAGTTCAAGCCATGACAGG - Intergenic
1190408236 X:50109139-50109161 AAACTACTTCAGGCCATGATGGG + Intergenic
1190569778 X:51769415-51769437 AGACTAGTTCAGGCCATGACAGG + Intergenic
1190687996 X:52891274-52891296 AAAGTAGTTCAGGCCATGATGGG - Intergenic
1190697986 X:52964518-52964540 AAAGTAGTTCAGGCCATGATGGG + Intronic
1190866938 X:54392613-54392635 AAACTAGTTGAGGCCATGATGGG + Intergenic
1191639870 X:63418482-63418504 ACACTGGTTCAGGCCATGACAGG - Intergenic
1191830943 X:65415629-65415651 AAACTAGTTCAGGCCATGATGGG - Intronic
1192016573 X:67337963-67337985 AATCTAGTGCAGGCTGATACTGG + Intergenic
1192359325 X:70429146-70429168 AAAGTAGTTCAAGCTGTGGATGG + Intronic
1192675914 X:73196625-73196647 AAGCTAGTTCAGGCCATGATAGG + Intergenic
1193416270 X:81228610-81228632 AATCTAGTTCAGGCCATGATGGG - Intronic
1193441726 X:81548967-81548989 AAACTAGTTCAGGTCATGATAGG + Intergenic
1193666793 X:84329238-84329260 AAATTAGTTCAGGCCATGATGGG - Intronic
1193696262 X:84710188-84710210 AAACTGGTTCAGGCCATGATGGG - Intergenic
1193850803 X:86535442-86535464 AAACTATTTCAGGCCATGATGGG + Intronic
1193959201 X:87902574-87902596 AAACTGGTTCAGGCCATGACTGG + Intergenic
1194047203 X:89023363-89023385 AAACTAGCTCAGGCCATGATGGG - Intergenic
1194104624 X:89753549-89753571 AGACTGGTTCAGGCTATGATGGG - Intergenic
1194132009 X:90092850-90092872 AGACTGGTTCAGGCTATGATGGG + Intergenic
1194148739 X:90297039-90297061 AAACTAGTTCAGGCCACAACGGG - Intergenic
1194232407 X:91340583-91340605 AAACTAGTTCTGGCCATAACAGG + Intergenic
1194483587 X:94457773-94457795 AAACTAGTTCAGACTGTGATGGG - Intergenic
1195447760 X:104973209-104973231 AAACTAACTCAGGCCATGACAGG - Intronic
1195463480 X:105154235-105154257 AAACTAATTCAGGCCATGACAGG - Intronic
1195493057 X:105495877-105495899 AAACTGGTTCAGGCCATGACAGG + Intronic
1195546425 X:106117218-106117240 ACACTAGTTCAGGCCATGATGGG - Intergenic
1195565692 X:106336713-106336735 AAACTAGTTCAGGCCATGATGGG - Intergenic
1196104794 X:111884337-111884359 AAACTAGTTAAGGTAGTGCCAGG + Intronic
1196301986 X:114058372-114058394 AGACTGGTTGAGGCTGTGATGGG + Intergenic
1196763132 X:119218171-119218193 AAACTAGTTCAGGCCATGATGGG - Intergenic
1197351378 X:125387602-125387624 AAACTAGATCAGGCCATGATGGG - Intergenic
1197468190 X:126832877-126832899 AAACTAGTTCAGGCCATGATGGG - Intergenic
1198123626 X:133620586-133620608 AAACTAGTTCAGGCCATGATGGG + Intronic
1199260415 X:145767085-145767107 AAACTAGTTCAGGCAATGATGGG + Intergenic
1200456578 Y:3401328-3401350 AGACTGGTTCAGGCTATGATGGG - Intergenic
1200495110 Y:3873771-3873793 AAACTAGTTCAGGCCACAACGGG - Intergenic
1201148279 Y:11078753-11078775 AAACTAGTTCAAGGCATGACGGG + Intergenic
1201236213 Y:11914547-11914569 AAACTGGTTCAGGCCATGATGGG - Intergenic
1201260720 Y:12156674-12156696 AAGCTAGTTCAGGCTATGATGGG - Intergenic
1201263890 Y:12187343-12187365 AAACTGGTTCAGGCTGGGCACGG + Intergenic
1202598431 Y:26568146-26568168 AGACTACTTCAGGCTGAGAAGGG - Intergenic