ID: 938036149

View in Genome Browser
Species Human (GRCh38)
Location 2:128036664-128036686
Sequence CTAGTTTTTCAGGTGTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938036143_938036149 -1 Left 938036143 2:128036642-128036664 CCCATTCCTGTCACAGCCTGAAC No data
Right 938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG No data
938036142_938036149 7 Left 938036142 2:128036634-128036656 CCAAACGTCCCATTCCTGTCACA No data
Right 938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG No data
938036144_938036149 -2 Left 938036144 2:128036643-128036665 CCATTCCTGTCACAGCCTGAACT No data
Right 938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG No data
938036145_938036149 -7 Left 938036145 2:128036648-128036670 CCTGTCACAGCCTGAACTAGTTT 0: 3
1: 3
2: 48
3: 256
4: 509
Right 938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938036149 Original CRISPR CTAGTTTTTCAGGTGTCTTT GGG Intergenic
No off target data available for this crispr