ID: 938038920

View in Genome Browser
Species Human (GRCh38)
Location 2:128059608-128059630
Sequence AAGAAGAAGAAGAATGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938038917_938038920 27 Left 938038917 2:128059558-128059580 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG No data
938038918_938038920 23 Left 938038918 2:128059562-128059584 CCTGGGCAACAGAGTGAGACTCT 0: 7153
1: 33807
2: 89412
3: 168027
4: 203499
Right 938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938038920 Original CRISPR AAGAAGAAGAAGAATGTGGC CGG Intergenic
No off target data available for this crispr