ID: 938041211

View in Genome Browser
Species Human (GRCh38)
Location 2:128077776-128077798
Sequence TATGCAGGAGCACACGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938041206_938041211 18 Left 938041206 2:128077735-128077757 CCTTTAAAGATCTTTTTTGCTCG No data
Right 938041211 2:128077776-128077798 TATGCAGGAGCACACGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938041211 Original CRISPR TATGCAGGAGCACACGCAAG GGG Intergenic
No off target data available for this crispr