ID: 938044180

View in Genome Browser
Species Human (GRCh38)
Location 2:128101802-128101824
Sequence CCTTCTATGTGGAACTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938044180_938044186 10 Left 938044180 2:128101802-128101824 CCCTCCTAGTTCCACATAGAAGG No data
Right 938044186 2:128101835-128101857 CTGATCTCCCGCAATAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938044180 Original CRISPR CCTTCTATGTGGAACTAGGA GGG (reversed) Intronic
No off target data available for this crispr