ID: 938044619

View in Genome Browser
Species Human (GRCh38)
Location 2:128106791-128106813
Sequence CTTTGGAAGGGGCAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938044619_938044628 -8 Left 938044619 2:128106791-128106813 CCACCCACCTGCCCCTTCCAAAG No data
Right 938044628 2:128106806-128106828 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938044619 Original CRISPR CTTTGGAAGGGGCAGGTGGG TGG (reversed) Intronic
No off target data available for this crispr