ID: 938051614

View in Genome Browser
Species Human (GRCh38)
Location 2:128177877-128177899
Sequence GGAACGAGTGAGAATGAATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938051614 Original CRISPR GGAACGAGTGAGAATGAATC TGG Exonic
904700639 1:32355908-32355930 GGAGGGAATGAGAATGATTCTGG + Intronic
905591729 1:39169733-39169755 GCAAGGAGAGAGAATGAATGAGG - Intronic
905926280 1:41752179-41752201 AGAGGAAGTGAGAATGAATCCGG + Intronic
906838972 1:49115613-49115635 AGAAAGAGAGAGAAAGAATCCGG + Intronic
907266542 1:53265038-53265060 GGAAGGAGAGGGAATGAAGCAGG + Intronic
908079660 1:60562575-60562597 TGAATGAGTGAGAATGTATGTGG + Intergenic
908114296 1:60925723-60925745 GGAACGGGTGAGACAGAAACAGG - Intronic
912219780 1:107660139-107660161 GGAACAAGTGAGAATAAACTGGG - Intronic
916471127 1:165123780-165123802 GGAAAGAAGGAGAATGATTCAGG + Intergenic
918656826 1:187037213-187037235 GGAACAAATGAGAAAGAATCTGG + Intergenic
921203211 1:212826307-212826329 GGAATGAGTCAGGATGAAGCAGG + Intergenic
921807702 1:219474861-219474883 AGGACGAGTGAGAATTAACCAGG - Intergenic
923522532 1:234746823-234746845 GGAACCAGGGATAATGAGTCAGG - Intergenic
924041459 1:239988302-239988324 GGAAGGAGTCAGAATGCATAAGG + Intergenic
924151788 1:241137117-241137139 GGAAGGAGTAGGAATGAATAAGG - Intronic
924688810 1:246324993-246325015 GGAAGGAGGGAGAAGGAGTCGGG + Intronic
924688820 1:246325022-246325044 GGAAGGAGGGAGAAGGAGTCGGG + Intronic
924688840 1:246325079-246325101 GGAAGGAGGGAGAAGGAGTCGGG + Intronic
924688861 1:246325136-246325158 GGAAGGAGGGAGAAGGAGTCGGG + Intronic
924688896 1:246325222-246325244 GGAAGGAGGGAGAAGGAGTCGGG + Intronic
924688907 1:246325250-246325272 GGAAGGAGGGAGAAGGAGTCGGG + Intronic
924851804 1:247838527-247838549 GGAACGAGTGAGACCGGAACAGG + Intergenic
1063383072 10:5598685-5598707 AGAACGAGAGAGAATGAGACGGG + Intergenic
1064978004 10:21138120-21138142 GGTAGGAGGGAGCATGAATCTGG + Intronic
1065033171 10:21609217-21609239 GGAAAGAGTGAAAATGTAACTGG - Intronic
1065281098 10:24139507-24139529 GAAAAGAGTAAGAATGAAGCAGG - Intronic
1068014369 10:51496790-51496812 GGAACCAGTGAGAATTTAACAGG - Intronic
1068553818 10:58435574-58435596 GGGAAGAGGAAGAATGAATCAGG + Intergenic
1072485522 10:95850829-95850851 GGAAAGAATGGGAATGAAACTGG - Intronic
1072620915 10:97078727-97078749 GCAACGAGGGTGAATGAAGCAGG + Intronic
1073537101 10:104287505-104287527 GGAACGGCTGAAAATGAATGAGG + Intronic
1074195781 10:111183535-111183557 GGAAGGAGAGAGAACGCATCAGG - Intergenic
1074217907 10:111405762-111405784 AGAACAAGTGATAATGAATCGGG - Intergenic
1074275709 10:111999957-111999979 GGGAGGAGGGAGAATGAAACAGG + Intergenic
1074934168 10:118161209-118161231 GGCCAGAGTGAGAATGATTCGGG + Intergenic
1076282427 10:129259693-129259715 GGAAAGGGTGAGAGTGATTCTGG - Intergenic
1082889424 11:58122729-58122751 GGAAGGAGTAAGAATGAGGCAGG - Intronic
1087985276 11:104671066-104671088 GGAACTAGTGAGACAGTATCTGG + Intergenic
1092276794 12:7067555-7067577 GGAAGCAGTGAGGATGAACCTGG + Intronic
1092716506 12:11394466-11394488 GAACAGATTGAGAATGAATCGGG + Intronic
1093496163 12:19760780-19760802 AGAACATGTGAGAATGACTCAGG - Intergenic
1094680007 12:32659568-32659590 GGAATGAGTGAGAATCACTTGGG - Intergenic
1098645426 12:72894790-72894812 GGAAGGAGTGGGAATGAATGTGG + Intergenic
1099393622 12:82110972-82110994 GGAATGAGTGATACTGACTCTGG - Intergenic
1100915015 12:99410741-99410763 GGAACGACTGTGATTGAATCAGG + Intronic
1101764637 12:107686393-107686415 TGAAGGAGTGAGGATGAATGTGG + Intronic
1103960878 12:124608600-124608622 GGAAGAAGTGAGATTGAAACAGG - Intergenic
1106389456 13:29320831-29320853 GTACAAAGTGAGAATGAATCAGG + Intronic
1107975835 13:45687926-45687948 GGTACGGGTGACACTGAATCTGG + Intergenic
1109463287 13:62692321-62692343 GAAAAGAGTGAGAGTGAATGTGG - Intergenic
1109810234 13:67503898-67503920 GCAAAGAGTGAGAAAGAATTCGG - Intergenic
1110083629 13:71348177-71348199 GGAATGAGAGTGAAAGAATCAGG - Intergenic
1110347324 13:74463804-74463826 GGAAGGAGTGGGCAAGAATCGGG + Intergenic
1111625585 13:90781083-90781105 GGAAAGAGTGAGAAGGAAAATGG - Intergenic
1114797687 14:25735188-25735210 GGAATGAATTAGAATGAATGTGG + Intergenic
1115515847 14:34184186-34184208 GGAACAAGTGAGTCTGACTCAGG - Intronic
1115605263 14:34994713-34994735 GGAAAGACTGAGTATGAATTTGG - Intronic
1120002296 14:79316431-79316453 GGAACCAATGAAAATGACTCAGG + Intronic
1120640438 14:87004825-87004847 GGTACGTGTGAGAAAGAATGAGG - Intergenic
1126759406 15:51955606-51955628 AGAAAGAATGAGAATGAAGCTGG + Intronic
1128612851 15:69087785-69087807 GGGAGGAGTGAGAATGAATCAGG + Intergenic
1131107587 15:89745293-89745315 GGGACGAGGGAGAAGGAACCAGG + Intergenic
1131351435 15:91704389-91704411 GGAACCCATGAGAATGAATCTGG + Intergenic
1138263453 16:55642867-55642889 GGAAGGAGTGAGTCTCAATCTGG - Intergenic
1141814724 16:86401837-86401859 GGAACCAGAGAGAGAGAATCTGG - Intergenic
1147329104 17:39686064-39686086 GGAAAGAGAGAGCATGAATGGGG + Intronic
1147538907 17:41340199-41340221 GGAAGGAGAGAGAATGAGTGAGG - Intergenic
1149425670 17:56551972-56551994 GGAAAGAGAGAGAATGAAGGAGG + Intergenic
1153606242 18:6836322-6836344 GGAAAGAGTGAGAGTGAGTGAGG + Intronic
1154391059 18:13936618-13936640 GGAAGGAATAAGAATGTATCAGG - Intergenic
1159563170 18:70017258-70017280 GGAAGGCATGGGAATGAATCAGG - Intronic
1162039383 19:7960550-7960572 GGAACAAGGGAGAATTCATCAGG + Exonic
1162863503 19:13526061-13526083 GGAGAGAGAGAGAATGAAGCTGG + Intronic
1164621770 19:29700204-29700226 TGCACGAGTAAGAATGAATGGGG + Intronic
1166164318 19:40976609-40976631 GCAACGAGTTTGAAGGAATCTGG + Intergenic
1166186458 19:41142413-41142435 GCAACGAGTTTGAAGGAATCTGG - Intergenic
926449054 2:12980225-12980247 GGAAGGAGCCAGAATGAATATGG - Intergenic
927252144 2:21005935-21005957 GGAAAGACCCAGAATGAATCCGG + Exonic
927279324 2:21290031-21290053 GAAAGGAGAGAGAATGAATTGGG + Intergenic
928276858 2:29909247-29909269 TGAAAGAGTGAGAATGTATGTGG + Intronic
929302772 2:40325027-40325049 GGAAAGAGTGAGAAGGGATGTGG - Intronic
930590423 2:53320462-53320484 GGAATGAGGGAGAGTGACTCAGG - Intergenic
934614075 2:95760677-95760699 GGTATTGGTGAGAATGAATCAGG + Intergenic
934960818 2:98671148-98671170 GGAACATATGAGAATGTATCAGG - Intronic
937701640 2:124868930-124868952 TGAAAAAGTGAGAATGAATGGGG + Intronic
938051614 2:128177877-128177899 GGAACGAGTGAGAATGAATCTGG + Exonic
938765844 2:134460083-134460105 GGGGAGAGTGAGAATGAATTTGG - Intronic
940201174 2:151152712-151152734 GGAACGAGGGAGAGGGAATTAGG - Intergenic
940225546 2:151397512-151397534 GGAACGTGTTAAAATGACTCGGG - Intergenic
940333146 2:152497539-152497561 GGAATGAGTCAGAAAGAATGAGG - Intronic
940846285 2:158645651-158645673 GGATCGAGTCATGATGAATCTGG - Intronic
941029951 2:160499716-160499738 AGAAAGAGTAAGAATGAACCAGG - Intergenic
942844103 2:180402243-180402265 GGAATGAGGGAGAATCACTCTGG + Intergenic
943680799 2:190765804-190765826 GGAAGGAGAGATAAAGAATCAGG - Intergenic
943809794 2:192170558-192170580 GAAACGAGTAAGAATGCAGCTGG + Intronic
947924817 2:233912126-233912148 GGAACATGAGAGAATGAATGGGG - Intergenic
948781307 2:240323537-240323559 TGAAGAAGTGAGAGTGAATCCGG + Intergenic
1169851549 20:10057238-10057260 GGGAAGAGAGAGAATGAAGCAGG + Exonic
1174073599 20:47916307-47916329 GGAACCTGTGAGCATGAAACAGG + Intergenic
1175175741 20:57110749-57110771 GGAAAGAGTGCGAATGCAGCCGG - Intergenic
1181150778 22:20881744-20881766 GGAACAATTGAGAATGACACAGG - Intronic
1184589294 22:45470886-45470908 AGAACAAGTGAGAATGACTTAGG - Intergenic
949420030 3:3855933-3855955 GGAAAGAGTGAGGATTAAGCAGG - Intronic
950657494 3:14445612-14445634 GGAACCAGAGAGAATGCATGAGG - Intronic
951243531 3:20314383-20314405 GTAATGAGGGAGAATGAATGTGG - Intergenic
951828089 3:26890754-26890776 GGAACGAGAGGGAAGGAAGCTGG + Intergenic
954037497 3:47859481-47859503 GGAAAGATTGAGAATGGCTCTGG - Intronic
955275602 3:57544196-57544218 GGAAGTAGTGAGAAACAATCAGG - Exonic
955579247 3:60401313-60401335 GGAAGGAAAGAGAATGCATCTGG - Intronic
955615243 3:60800550-60800572 GGAACGAGGGAGAGTAAAACAGG + Intronic
956948958 3:74257920-74257942 GGAAGCAGTGAGGAAGAATCTGG - Intergenic
959137516 3:102442652-102442674 GGATGGAATGAGAATGAGTCTGG + Intronic
961554140 3:127686099-127686121 TGAATGAATGAGAATGAATGAGG - Intergenic
961554191 3:127686631-127686653 GGAATGAGTGAGAATGGATGAGG - Intergenic
961554277 3:127687478-127687500 GGAATGAGTGAGAATGAGTGGGG - Intergenic
963559307 3:146841871-146841893 GGAATGAGTTAAAATGAATCAGG + Intergenic
964251443 3:154722810-154722832 GAAACTAGGAAGAATGAATCTGG + Intergenic
971392876 4:26202455-26202477 GGAAAGAGTGAGGATGAAGCTGG - Intronic
973006752 4:45017408-45017430 GGAATGAGTTAGAATGGAGCAGG - Intergenic
973858692 4:55039390-55039412 GGAAAGAGAGAGAGAGAATCAGG + Intergenic
975591311 4:76002779-76002801 GGACTGAGTGAGGATGAATTGGG + Exonic
983605088 4:169574264-169574286 GGAAGGAGTGACAGTGAGTCAGG + Intronic
986063366 5:4212469-4212491 GGAGGGAGTGAGACGGAATCAGG + Intergenic
988408710 5:30857944-30857966 GGAAAGAGAGAGAATTAAGCTGG - Intergenic
988907432 5:35803603-35803625 GGAGTGAGTGAGAATGAAGAAGG - Intronic
989130077 5:38098691-38098713 GGGAGAAGTGAGACTGAATCAGG + Intergenic
989819539 5:45778972-45778994 GGATGGAGTAAGAATGTATCAGG + Intergenic
990938779 5:61178959-61178981 GGAACGAGGAAGAAGGAATTGGG - Intergenic
992191638 5:74297817-74297839 GGAACTAGGGAGTATGAATCTGG - Intergenic
994731049 5:103490679-103490701 GGAAGGAGGGAGAATGAAGGAGG - Intergenic
998553544 5:143101214-143101236 GGAAGGAATGAGAATGAGTCTGG + Intronic
999635355 5:153616210-153616232 GGAAGAAGTGACACTGAATCTGG - Intronic
999797836 5:155004738-155004760 GGAACCAGTGTGACTGAGTCTGG + Intergenic
1003367470 6:5489080-5489102 TGATAGAGTGAAAATGAATCAGG + Intronic
1005813917 6:29535222-29535244 GGAAGGGGTGAGCATGAAGCTGG + Intergenic
1006662929 6:35664002-35664024 GGAACCAGGGAGACTGACTCTGG + Intronic
1006866197 6:37210862-37210884 GGTAAAAGTAAGAATGAATCAGG + Intergenic
1007146239 6:39635973-39635995 GAAATGGGTGAGAATCAATCAGG - Intronic
1010853488 6:80807456-80807478 GAAAGGAGTGAAAATGAATGGGG + Intergenic
1011897692 6:92252052-92252074 GGAACAAGGGAGAATGAAGCAGG - Intergenic
1015093748 6:129389730-129389752 GGAAAGAGAGAGAATGAAAGGGG + Intronic
1015893950 6:137998493-137998515 GGCACGAGTAAGAAAGAAGCAGG + Intergenic
1017989655 6:159475077-159475099 GGAAGGGGCGAGAATTAATCAGG + Intergenic
1022597269 7:31724555-31724577 GGAAAGAATGAGCAAGAATCGGG - Intergenic
1023161592 7:37302094-37302116 GGAAGGAGTGGCAAAGAATCTGG - Intronic
1024764066 7:52635286-52635308 GGAAAGCATGAGAAGGAATCAGG - Intergenic
1032877537 7:136053664-136053686 GGAAAGTGGGAAAATGAATCAGG + Intergenic
1032928843 7:136641258-136641280 GAAATGACAGAGAATGAATCTGG + Intergenic
1034078232 7:148252761-148252783 GGAGCCAGGGAGCATGAATCAGG - Intronic
1035522495 8:286351-286373 GGAACCAGTTTGAATGAATTTGG - Intergenic
1037228735 8:16628076-16628098 GGAACCAATGAGAATAAATTAGG + Intergenic
1037910979 8:22743446-22743468 GGAACAAGTAAGGATGAAACGGG - Intronic
1038581340 8:28751708-28751730 GCAAAGAGTGAGAAAGAATAGGG + Exonic
1039986039 8:42448734-42448756 GGAAGAAGAGAGAAGGAATCTGG + Intronic
1043774358 8:84246204-84246226 GGAAAGAGAGAGAATGAGGCAGG - Intronic
1046173056 8:110537682-110537704 TGCACGAGTGAGGATGAATTAGG + Intergenic
1046598423 8:116288615-116288637 GGAATGAGTTTGAAGGAATCAGG - Intergenic
1046633974 8:116651379-116651401 GGAAAGACTGAGAAGGAAACAGG + Intronic
1048201569 8:132378708-132378730 GGAACGAGTGAGACTTCCTCTGG - Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1051517274 9:17943931-17943953 GGAACGAGAGAGAGGGAATAGGG + Intergenic
1051930801 9:22382951-22382973 GGAAAGTGGGAGGATGAATCAGG + Intergenic
1052375322 9:27712479-27712501 AGAACGAGTGAGAGAGAATTGGG + Intergenic
1055653576 9:78431944-78431966 AGAACAAATGAGAATGACTCTGG - Intergenic
1057395923 9:94680193-94680215 GGATCAAGTCAGAATGAACCTGG + Intergenic
1059307341 9:113364617-113364639 AGAACGAGCGACAATGAATGTGG - Intronic
1059498359 9:114729361-114729383 GGAACCACTGAGAATGGATTTGG + Intergenic
1060032148 9:120224239-120224261 TGAACAAGTGTGAATGAATCAGG + Intergenic
1060946838 9:127574694-127574716 GCAAGGAGTGTGAATGAATCAGG + Intronic
1186637543 X:11422584-11422606 GGAAAGTCTGAGAATGAAACAGG + Intronic