ID: 938052814

View in Genome Browser
Species Human (GRCh38)
Location 2:128190660-128190682
Sequence GCCCGTCAGGGTCAGGGTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 369}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938052803_938052814 17 Left 938052803 2:128190620-128190642 CCTTACTGAATACAGCCATACTC 0: 1
1: 0
2: 0
3: 15
4: 84
Right 938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG 0: 1
1: 1
2: 1
3: 39
4: 369
938052806_938052814 -9 Left 938052806 2:128190646-128190668 CCCTCTCGCATCCAGCCCGTCAG 0: 1
1: 0
2: 1
3: 3
4: 106
Right 938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG 0: 1
1: 1
2: 1
3: 39
4: 369
938052804_938052814 2 Left 938052804 2:128190635-128190657 CCATACTCAGCCCCTCTCGCATC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG 0: 1
1: 1
2: 1
3: 39
4: 369
938052802_938052814 24 Left 938052802 2:128190613-128190635 CCAGTTTCCTTACTGAATACAGC 0: 1
1: 0
2: 1
3: 11
4: 199
Right 938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG 0: 1
1: 1
2: 1
3: 39
4: 369
938052805_938052814 -8 Left 938052805 2:128190645-128190667 CCCCTCTCGCATCCAGCCCGTCA 0: 1
1: 0
2: 0
3: 6
4: 106
Right 938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG 0: 1
1: 1
2: 1
3: 39
4: 369
938052807_938052814 -10 Left 938052807 2:128190647-128190669 CCTCTCGCATCCAGCCCGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG 0: 1
1: 1
2: 1
3: 39
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938052814 Original CRISPR GCCCGTCAGGGTCAGGGTCA GGG Exonic
900225822 1:1533257-1533279 GTGGGTCAGGGTCAGGGTCAGGG - Intronic
900345747 1:2209548-2209570 GCCCGACAGGGTCCGGGTGCAGG - Intronic
900369464 1:2324882-2324904 GCCAGGCAGGATCTGGGTCAGGG + Intronic
900617127 1:3570529-3570551 GCCAGACAGGGTGAGAGTCAAGG + Intronic
901060508 1:6469708-6469730 GGCCAGCAGGGTCAGGGCCAGGG + Intronic
901146573 1:7069064-7069086 GCCCAGCAGGGTCAAGGGCATGG - Intronic
901325960 1:8365254-8365276 GCCCCTCAGGTTCAGCGTCCCGG + Intronic
901511719 1:9721034-9721056 GCCAGCCAGGGTCAGGGTGGTGG - Intronic
902536742 1:17123344-17123366 GCCAGGCAGGGCCAGGGTTATGG - Intergenic
902634962 1:17729066-17729088 GGCAGTCAGGGTCAGGGACAGGG + Intergenic
902985678 1:20152736-20152758 GCCCGCTAGGGACAGGGCCAGGG - Intergenic
903928888 1:26850911-26850933 GCCAGACAAGGTCAGGGTGATGG - Intronic
904316735 1:29670698-29670720 GCCAGGAAGGGTCAGGGTCAGGG + Intergenic
904392725 1:30196464-30196486 GCCCATCTGGGCCAGGGCCAGGG - Intergenic
904674131 1:32187841-32187863 GCCTGAGAGGGTAAGGGTCAGGG + Intronic
904896869 1:33824256-33824278 GCCTGTGAGGGTCAGGGCCATGG + Intronic
904992331 1:34603102-34603124 GCACGTCAGGGGCTGGGTGAGGG + Intergenic
905440854 1:37996061-37996083 GGCAGCCAGGGTCAGGGACAAGG + Intergenic
905632021 1:39524273-39524295 GCCCCTGAGGGGCAGGGGCAAGG - Intronic
905647904 1:39637357-39637379 GCCTCTCGGGGTCAGGGGCAGGG - Intronic
905653049 1:39669182-39669204 GCCTTTCAGGGTCAGGCTGATGG + Intronic
905665735 1:39761933-39761955 GCCCCTGAGGGGCAGGGGCAAGG + Intronic
906719320 1:47994192-47994214 GCCCGTCTGGGTGATGCTCATGG - Exonic
906948408 1:50315329-50315351 GCCAGTCAGGGTCAGGACTAGGG + Intergenic
913957368 1:143318340-143318362 GATTGTCAGGGCCAGGGTCAGGG + Intergenic
913958062 1:143321183-143321205 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
913958342 1:143322133-143322155 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
914051682 1:144143704-144143726 GATTGTCAGGGCCAGGGTCAGGG + Intergenic
914052371 1:144146541-144146563 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
914052657 1:144147508-144147530 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
914126540 1:144819033-144819055 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
914126826 1:144820000-144820022 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
914127515 1:144822837-144822859 GATTGTCAGGGCCAGGGTCAGGG - Intergenic
915129453 1:153686790-153686812 GCCAGTCAGGGGCAGAGCCAGGG - Intronic
916470576 1:165118766-165118788 GAGCGTCAGGGTTAGGGTCCAGG + Intergenic
918697319 1:187560395-187560417 ATTGGTCAGGGTCAGGGTCAGGG + Intergenic
918697321 1:187560401-187560423 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
920059604 1:203218211-203218233 GCTGGTCAAGGTCAAGGTCAAGG + Intronic
920221830 1:204409989-204410011 GCCCTTCAGGGTCTTGTTCAAGG + Exonic
920567558 1:206987128-206987150 GCCCGACAAGGACAGGGTGAGGG - Intergenic
922091884 1:222403425-222403447 GTGGGTCAGGGTCTGGGTCAGGG + Intergenic
922946150 1:229515871-229515893 ACCTGTCAGGCCCAGGGTCAGGG + Intergenic
923010672 1:230085211-230085233 GCCCCACAGGGTCACTGTCAGGG - Intronic
1065631452 10:27685125-27685147 GACCTTCAGGGCCAGGGCCAGGG - Intronic
1066759324 10:38738434-38738456 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1066759614 10:38739411-38739433 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1066962006 10:42233349-42233371 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
1066962305 10:42234345-42234367 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
1067832665 10:49619436-49619458 GCTGGTCAGTGGCAGGGTCAGGG + Intronic
1075767345 10:124904160-124904182 TCCTGGCAGGGTCGGGGTCAGGG - Intergenic
1076190915 10:128482811-128482833 GCCAGGCAGGGTGAGGGTGAGGG + Intergenic
1076725767 10:132412347-132412369 GCCCGGTGGGGTCAGGGGCAAGG - Intronic
1076829438 10:132986611-132986633 TCCCCTGAGGGTCAGGGACAGGG + Intergenic
1076918872 10:133441138-133441160 GTCCATCAGGGTCCAGGTCAGGG + Intergenic
1076918974 10:133441490-133441512 GTCTGTCGGGGTCTGGGTCAGGG + Intergenic
1076963666 10:133787189-133787211 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1076963668 10:133787195-133787217 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1076963670 10:133787201-133787223 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1076963672 10:133787207-133787229 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1076963695 10:133787262-133787284 CGGGGTCAGGGTCAGGGTCAGGG + Intergenic
1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG + Intergenic
1078640804 11:13094074-13094096 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1078640806 11:13094080-13094102 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1078640808 11:13094086-13094108 GGCACACAGGGTCAGGGTCAGGG - Intergenic
1080527193 11:33135216-33135238 CACAGTCAGGGTCAGGGTTAGGG - Intronic
1080842528 11:35998029-35998051 GGCAGCCAGGGACAGGGTCAGGG + Intronic
1081929439 11:46858543-46858565 GCCCATCAGGGGCTGGGACATGG - Exonic
1083653892 11:64219893-64219915 GCCCTTCAGGGTCAGCTTCCGGG - Exonic
1083783111 11:64928256-64928278 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1083783113 11:64928262-64928284 CAGAGTCAGGGTCAGGGTCAGGG - Intronic
1083868500 11:65471893-65471915 GCCCCTCAGGGTGGGGGCCATGG - Intergenic
1084425274 11:69080936-69080958 TGGGGTCAGGGTCAGGGTCATGG + Intronic
1084950729 11:72664005-72664027 GCCAGTGAGGGTCAGGGTACTGG + Intronic
1091393396 12:139234-139256 GCGCGGCAGGCTCAGGATCATGG - Exonic
1091638442 12:2215641-2215663 GCCCTTCAGGGACAGGCTCCAGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092010483 12:5106554-5106576 GCCTGTCGGGGGAAGGGTCATGG + Intergenic
1095988647 12:48017999-48018021 CCCTGTCAGGGCCAGGCTCAGGG - Intergenic
1096470057 12:51869949-51869971 GCCCCTGTGGGTCAGGGCCAGGG + Intergenic
1103717740 12:122955504-122955526 GCCCCTCAGGGGCAGGGGCCAGG - Intronic
1104765622 12:131328237-131328259 GCCGGCCAGGGTCAGGATCCAGG - Intergenic
1104813699 12:131633815-131633837 GCCGGCCAAGGTCAGGGTCCAGG + Intergenic
1106554605 13:30798738-30798760 GAGAGCCAGGGTCAGGGTCACGG - Intergenic
1106969100 13:35114553-35114575 GACTTTCAGGGTCAGGGCCAAGG - Intronic
1109370498 13:61415008-61415030 GCCGGTAAGGGTTAGGGTCAAGG - Exonic
1112506282 13:99978158-99978180 GCCCGTCTGTGGCAGTGTCAGGG - Intergenic
1112506554 13:99979761-99979783 GCGGGTCAGGCTCAGGGTCTCGG - Intergenic
1112907800 13:104445890-104445912 GCCTGTCGGGGTGGGGGTCAAGG + Intergenic
1113718041 13:112528097-112528119 GCCCGTCAGGGTCAGGGCAGGGG - Intronic
1113861541 13:113490621-113490643 GCCCGTCGGGGTCGGGGTCGGGG - Intronic
1114030344 14:18573025-18573047 ATGGGTCAGGGTCAGGGTCAGGG + Intergenic
1114030346 14:18573031-18573053 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1114030348 14:18573037-18573059 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1114646380 14:24258783-24258805 GACTGCCAGGGTCAGGGCCACGG + Intronic
1122080997 14:99267961-99267983 GCCAGACAGGGCCAGGGTGAAGG - Intronic
1122630956 14:103107598-103107620 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1122630960 14:103107604-103107626 GCGGCCCAGGGTCAGGGTCAGGG - Intronic
1122675486 14:103409289-103409311 GCCTGTCGGGGTGAGGGGCAAGG + Intronic
1122718201 14:103707756-103707778 GCCCCTCAGGGCAAGGCTCAAGG + Intronic
1122969896 14:105148266-105148288 GACCGCCAGGGCCAGGGTCCTGG + Intronic
1202930067 14_KI270725v1_random:28051-28073 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1202931002 14_KI270725v1_random:31705-31727 GATTGTCAGGGCCAGGGTCAGGG - Intergenic
1123421427 15:20139973-20139995 GATTGTCAGGGCCAGGGTCAGGG + Intergenic
1123442765 15:20303160-20303182 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1123443049 15:20304116-20304138 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1123530653 15:21146513-21146535 GATTGTCAGGGCCAGGGTCAGGG + Intergenic
1129108514 15:73324318-73324340 GGCAGTCAGGGCCAAGGTCAGGG - Intronic
1129944153 15:79524617-79524639 CCCCTTCTGGGTCTGGGTCAAGG + Intergenic
1130553975 15:84910026-84910048 AGAGGTCAGGGTCAGGGTCAGGG - Intronic
1130657065 15:85799137-85799159 GCATGTCAGGGTCAGGAACAGGG - Intergenic
1131092605 15:89633673-89633695 CCGCGTCAAGGTCAGGCTCACGG - Exonic
1132455456 16:19623-19645 CCGGGTCAGGGTTAGGGTCAGGG - Intergenic
1132455501 16:19759-19781 GAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1132455513 16:19801-19823 TAGAGTCAGGGTCAGGGTCAGGG - Intergenic
1132455521 16:19831-19853 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1132455523 16:19837-19859 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1132455525 16:19843-19865 AAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1132455532 16:19862-19884 CAGGGTCAGGGTCAGGGTCAAGG - Intergenic
1132455533 16:19868-19890 AAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1132879582 16:2156000-2156022 GACGGTCGGGGTCGGGGTCAGGG + Intronic
1134869455 16:17638592-17638614 GCACATCAGGGTCAGGTACAGGG + Intergenic
1136247804 16:28985357-28985379 GCCCCTCAAGGGCAGAGTCAAGG - Exonic
1136571630 16:31101246-31101268 GCCCGTCATGCTCAGGGTTGGGG - Intergenic
1136688419 16:32009817-32009839 CTCTGTCAGGGTCAGGGTCATGG - Intergenic
1136718203 16:32301566-32301588 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
1136718487 16:32302554-32302576 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
1136773770 16:32860580-32860602 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1136789014 16:32953356-32953378 CTCTGTCAGGGTCAGGGTCATGG - Intergenic
1136836577 16:33507836-33507858 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
1136836862 16:33508824-33508846 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
1136862574 16:33712399-33712421 CCAGGTCAGGGTCAGGGCCAGGG - Intergenic
1136862807 16:33713163-33713185 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1136880798 16:33900578-33900600 CTCTGTCAGGGTCAGGGTCATGG + Intergenic
1136896842 16:34000939-34000961 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
1137786011 16:51138499-51138521 GCCTGGGAGGGTCAGGATCATGG - Intronic
1139549683 16:67666540-67666562 GCACGCCAGGGTCAGGGTGCCGG - Exonic
1141280577 16:82627192-82627214 GCCCGGCACGGGCAGGGTGAGGG + Intronic
1141479657 16:84297964-84297986 GCCCTTGAGGGTCAGGGCCAAGG - Intronic
1141800382 16:86304063-86304085 GCCCCGCAGGGTCAGTGCCAAGG - Intergenic
1142107534 16:88313054-88313076 CCTGGTCAGGGTCACGGTCAGGG + Intergenic
1203007941 16_KI270728v1_random:215211-215233 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1203008225 16_KI270728v1_random:216199-216221 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1203076188 16_KI270728v1_random:1122691-1122713 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1203091216 16_KI270728v1_random:1214847-1214869 CTCTGTCAGGGTCAGGGTCATGG - Intergenic
1203124069 16_KI270728v1_random:1560589-1560611 CCAGGTCAGGGTCAGGGCCAGGG - Intergenic
1203124284 16_KI270728v1_random:1561304-1561326 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1203146603 16_KI270728v1_random:1807573-1807595 GCGGGGCAGGGTCAGGGCCACGG + Intergenic
1203146764 16_KI270728v1_random:1808137-1808159 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
1142467018 17:141887-141909 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1142467020 17:141893-141915 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1142467022 17:141899-141921 TAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1142467025 17:141905-141927 TCCAGTTAGGGTCAGGGTCAGGG - Intergenic
1142467184 17:142706-142728 CCCCTTCAGGGTCAGGGTCAGGG - Intergenic
1142648554 17:1330941-1330963 GCCCGTCGGGGAGAGGGGCAGGG - Intergenic
1143098805 17:4493410-4493432 CTCAGTCAGGGTCGGGGTCAGGG + Intergenic
1143106985 17:4534899-4534921 TGCCGGCAGGGTCAGGGTCCCGG + Intronic
1143386698 17:6535195-6535217 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1145296053 17:21593364-21593386 GCCCTTCAGGGTCAGCTTCTGGG - Intergenic
1145367741 17:22278697-22278719 GCCCTTCAGGGTCAGCTTCTGGG + Intergenic
1147149407 17:38505536-38505558 CTCTGTCAGGGTCAGGGTCATGG - Intronic
1147959009 17:44154814-44154836 GCCCATCAGTCTCGGGGTCAAGG - Intronic
1147978196 17:44259774-44259796 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1148619511 17:49023662-49023684 GCCAGTCAGGGGCAGGTTAAGGG + Intronic
1149998598 17:61417742-61417764 CTCCGTCAGGCTCTGGGTCAAGG + Intergenic
1151702064 17:75748807-75748829 GGGGGTCAGGGTCAGGGTCATGG - Intronic
1152521264 17:80858226-80858248 TCCAGTCAGGGTCAGGAGCACGG - Intronic
1152592834 17:81222301-81222323 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1152612558 17:81322877-81322899 GGGGGTCAGGGTCAGGGTCAGGG - Intronic
1152964896 18:105613-105635 GAGGGTCAGGGTGAGGGTCAGGG - Intergenic
1152964900 18:105625-105647 GAGGGTCAGGGTGAGGGTCAGGG - Intergenic
1153011695 18:545486-545508 ACCCGTAAGTGACAGGGTCAGGG - Intergenic
1153391065 18:4560129-4560151 GCCTGTCAGGGTTGGGGTCAAGG - Intergenic
1153748939 18:8209815-8209837 GCCTGTCAGGGTGAGGGGTAAGG + Intronic
1154122441 18:11662943-11662965 GCCCATCAGGGGCAGTGTGAGGG + Intergenic
1154176125 18:12088002-12088024 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1154415187 18:14172377-14172399 ACCTGGCAGGGCCAGGGTCAGGG + Intergenic
1155012676 18:21796385-21796407 GCCTGTCAGGGTGGGGGGCAAGG + Intronic
1157764415 18:50286100-50286122 GCCGGGCAGGGTCAGGGACAGGG - Exonic
1160653243 19:245789-245811 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
1160653245 19:245795-245817 CGGGGTCAGGGTCAGGGTCAGGG - Intergenic
1160950727 19:1665993-1666015 CCCTGACAGGGTCAGGTTCAGGG - Intergenic
1161619071 19:5288978-5289000 GCCTGTCAGGGGCAGGGACGAGG + Intronic
1161973270 19:7595770-7595792 GCGCGCCAGGGTCCGGGTCCGGG + Intergenic
1163019351 19:14474282-14474304 GCCCGCCAGGCTCAGGTTGAGGG + Exonic
1164750767 19:30653248-30653270 GCCCTTCAGCTCCAGGGTCATGG + Intronic
1165356772 19:35309355-35309377 GTCCGTGAGGGTCAGGGTATGGG + Intronic
1165652945 19:37507116-37507138 GCCCGTGAGGGTCAATGACAAGG + Intronic
1165771892 19:38385087-38385109 TACCCTCAGGGACAGGGTCAAGG + Intronic
1165865645 19:38935559-38935581 GACCTTCAGGGTGGGGGTCATGG + Intronic
1166137779 19:40787619-40787641 GGGGGTCAGGGCCAGGGTCAGGG + Intronic
1166755305 19:45187150-45187172 AGGGGTCAGGGTCAGGGTCAGGG + Intronic
1166806279 19:45489135-45489157 TGGGGTCAGGGTCAGGGTCAGGG + Intronic
1166855721 19:45781872-45781894 CCGCCTCAGGGTCAGGGTCAGGG - Intronic
1167386241 19:49165883-49165905 GGCCGTCAGAGCCAGGGCCAGGG + Intronic
1168726659 19:58586574-58586596 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1168726661 19:58586580-58586602 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1168726663 19:58586586-58586608 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1168726673 19:58586617-58586639 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1168726675 19:58586623-58586645 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1202691078 1_KI270712v1_random:96128-96150 GATTGTCAGGGCCAGGGTCAGGG + Intergenic
1202691769 1_KI270712v1_random:98965-98987 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
1202692054 1_KI270712v1_random:99932-99954 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
924958174 2:10341-10363 CACGGTCAGGGTCAGGGTCAGGG - Intergenic
924958180 2:10359-10381 TCGGGTTAGGGTCAGGGTCACGG - Intergenic
925371620 2:3349561-3349583 GCCAGACAGGGACAGGGACAGGG + Intronic
925969272 2:9095715-9095737 GCCCGACAGGGGCAGGGTGGTGG - Intergenic
930244537 2:48969759-48969781 GCCCATCAGGGGCAGGGACCTGG - Intronic
932733706 2:74239365-74239387 CTTCTTCAGGGTCAGGGTCATGG + Exonic
933954343 2:87354040-87354062 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
933954619 2:87354985-87355007 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
933955315 2:87357823-87357845 GATTGTCAGGGCCAGGGTCAGGG - Intergenic
934238816 2:90251211-90251233 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
934239503 2:90254036-90254058 GATTGTCAGGGCCAGGGTCAGGG - Intergenic
934273692 2:91562707-91562729 GATTGTCAGGGCCAGGGTCAGGG + Intergenic
934274380 2:91565499-91565521 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
934274655 2:91566450-91566472 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
934322932 2:91983750-91983772 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
934460957 2:94213591-94213613 GCATTTCAGGGTCAGGGCCATGG - Intergenic
934461243 2:94214542-94214564 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
934461947 2:94217390-94217412 GATTGTCAGGGCCAGGGTCAGGG - Intergenic
936247119 2:110837921-110837943 GCCTGGCTGGGCCAGGGTCAGGG + Intronic
936569548 2:113602782-113602804 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
937268915 2:120634727-120634749 GCGCCTCAGGCTCTGGGTCATGG + Intergenic
937288081 2:120765577-120765599 GCCCCTCAGGATCTGGTTCAGGG + Intronic
937436421 2:121885519-121885541 GCCCCTCAGGGTTAGGCTCAGGG + Intergenic
938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG + Exonic
939962844 2:148581083-148581105 GCTCGTCATTGCCAGGGTCAAGG - Intergenic
941130716 2:161647289-161647311 GCCTGTCAGGGTGATTGTCAAGG + Intronic
943926135 2:193782892-193782914 GCCTGTCGGGGTGAGGGGCAGGG - Intergenic
949089090 2:242183395-242183417 CGGGGTCAGGGTCAGGGTCAGGG + Intergenic
949089092 2:242183401-242183423 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
949089094 2:242183407-242183429 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1169043536 20:2516865-2516887 GGGCGTGAGGTTCAGGGTCAAGG + Intronic
1169936270 20:10886925-10886947 GCCTGTAAGGGTGCGGGTCAAGG - Intergenic
1171145010 20:22774092-22774114 GCACATCAGGGTCAGCATCAGGG + Intergenic
1172248967 20:33465621-33465643 GCTGGTCAGGGTCAGGGTGGGGG + Intergenic
1173193329 20:40893740-40893762 GCTAGTCAGGGACAAGGTCAGGG + Intergenic
1174339642 20:49887777-49887799 GGGCGTCAGGGGCAGGGCCATGG - Intronic
1174759773 20:53195623-53195645 ACCCGTCAGGGTCACTGTCCTGG - Intronic
1175919263 20:62442391-62442413 GTCAGTCAGGGTCTTGGTCAGGG + Intergenic
1175986454 20:62766274-62766296 GCTGGTCAGGCTCAGGGGCAGGG + Intergenic
1176278308 20:64286827-64286849 TAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176278310 20:64286833-64286855 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176278312 20:64286839-64286861 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176278320 20:64286864-64286886 AAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176278322 20:64286870-64286892 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176278324 20:64286876-64286898 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
1176592082 21:8656633-8656655 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1176593025 21:8660327-8660349 GATTGTCAGGGCCAGGGTCAGGG - Intergenic
1178411173 21:32364926-32364948 GCCCTGCAGGGCCAGGGCCAGGG - Intronic
1178465047 21:32840380-32840402 GCTCTTCAGGGGCAGGGCCAGGG + Intergenic
1180179826 21:46113015-46113037 TCCCGTGAGGGTCAGCGTTAGGG + Intronic
1180184852 21:46134443-46134465 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180184896 21:46134587-46134609 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180184931 21:46134701-46134723 GAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180184933 21:46134707-46134729 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180199424 21:46215635-46215657 GCAGCCCAGGGTCAGGGTCAGGG - Intronic
1180274933 22:10633762-10633784 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1180275872 22:10637454-10637476 GATTGTCAGGGCCAGGGTCAGGG - Intergenic
1180454459 22:15500082-15500104 ATGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180454461 22:15500088-15500110 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180454463 22:15500094-15500116 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1180549405 22:16528689-16528711 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1180549689 22:16529644-16529666 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1181354303 22:22289379-22289401 GATTGTCAGGGCCAGGGTCAGGG + Intergenic
1181354975 22:22292128-22292150 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
1181355288 22:22293147-22293169 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
1182724506 22:32432495-32432517 GCCCTTCATGGTGAGGATCATGG - Exonic
1183683754 22:39350186-39350208 GCCCGTTGGGGTCGGGGTCGGGG - Intronic
1183698255 22:39435450-39435472 GCCCTTCAGGGGCTGGGTGAGGG - Intronic
1183964074 22:41430891-41430913 ACCCGTCAGGGTCAGGGAAGAGG - Intergenic
1184379847 22:44138419-44138441 GCCAGCCAGGGTCAGGGTAAAGG + Intronic
1184478179 22:44732522-44732544 GCCTGTCAGGGCCAGGGACCGGG + Intronic
1184581730 22:45422533-45422555 GCCCATCAGGGTCTCTGTCAGGG - Intronic
1185056936 22:48586073-48586095 GCCAGCGAGGGCCAGGGTCAGGG - Intronic
1185065589 22:48630296-48630318 GCTGGTCAGTGCCAGGGTCAGGG - Intronic
1185206505 22:49541894-49541916 GGAGGTCAGGGTCAAGGTCAGGG - Intronic
1185319732 22:50195051-50195073 GCGGGCAAGGGTCAGGGTCAGGG + Intronic
949089242 3:10340-10362 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
949089244 3:10346-10368 CAGGGTCAGGGTCAGGGTCAGGG - Intergenic
949089246 3:10352-10374 TAGGGTCAGGGTCAGGGTCAGGG - Intergenic
954016638 3:47697600-47697622 TCCCTTAAGAGTCAGGGTCAAGG - Intronic
954134765 3:48576830-48576852 TTCCCCCAGGGTCAGGGTCAGGG + Intronic
954150382 3:48654434-48654456 GCCCGTCAGGTCCAGGGACCTGG + Exonic
956145321 3:66186018-66186040 GCGTGTCAGGGTCAGAATCATGG - Intronic
958929052 3:100189832-100189854 GCCTGTCTGGGTCAGGGGCATGG - Intronic
960060946 3:113320327-113320349 GAGATTCAGGGTCAGGGTCAGGG - Intronic
961336977 3:126186499-126186521 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
961336983 3:126186511-126186533 AGCCCTCAGGCTCAGGGTCAGGG - Intronic
966280370 3:178219636-178219658 GCCTGTCAGGGTTGGGGGCAAGG - Intergenic
966742731 3:183249413-183249435 GCCTCTCAGGGACAGGGACAGGG - Intronic
968298636 3:197596516-197596538 GCCTGGCAGGGGCAGGGGCAGGG + Intergenic
968364442 3:198173699-198173721 AAGGGTCAGGGTCAGGGTCAGGG + Intergenic
969271438 4:6105990-6106012 GCCGGTCAGGGTCAGGGTCAGGG + Intronic
969271441 4:6105996-6106018 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
969271443 4:6106002-6106024 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
969271445 4:6106008-6106030 CAGGGTCAGGGTCAGGGTCAGGG + Intronic
971167414 4:24198477-24198499 CCCCCTCAGGGTCAGGGCTAGGG + Intergenic
981391868 4:144200302-144200324 GCCTGTCAGGGTTGGGGGCAGGG + Intergenic
984814181 4:183821790-183821812 GCCCGGCAGGAACAGGGACAGGG - Intergenic
985462848 4:190122527-190122549 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462850 4:190122533-190122555 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462852 4:190122539-190122561 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462879 4:190122615-190122637 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462881 4:190122621-190122643 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462883 4:190122627-190122649 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985462885 4:190122633-190122655 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985464626 4:190182591-190182613 TCCCGTTAGGGTTAGGGTTATGG - Intronic
985471406 5:49514-49536 GCACTTCCGGGTTAGGGTCAGGG + Intergenic
985471409 5:49520-49542 CCGGGTTAGGGTCAGGGTCAGGG + Intergenic
985471411 5:49526-49548 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471419 5:49550-49572 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471425 5:49577-49599 GCACTTCCGGGTTAGGGTCAGGG + Intergenic
985471436 5:49616-49638 GCACTTCCGGGTTAGGGTCAGGG + Intergenic
985471449 5:49661-49683 GCACTTCCGGGTTAGGGTCAGGG + Intergenic
985471452 5:49667-49689 CCGGGTTAGGGTCAGGGTCAGGG + Intergenic
985471454 5:49673-49695 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471462 5:49697-49719 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471468 5:49724-49746 GCACTTCTGGGTCAGGGTCAGGG + Intergenic
985471470 5:49730-49752 CTGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471472 5:49736-49758 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471474 5:49742-49764 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985471482 5:49766-49788 TAGGGTCAGGGTCAGGGTCAGGG + Intergenic
985819651 5:2151002-2151024 CCTGGGCAGGGTCAGGGTCAGGG + Intergenic
986005230 5:3661958-3661980 GCCCTACAGGGCCAGGGTCCTGG + Intergenic
994267899 5:97739419-97739441 GCCTGAAAAGGTCAGGGTCAGGG + Intergenic
997702156 5:135910198-135910220 GAAGGTCTGGGTCAGGGTCAGGG + Intergenic
997702158 5:135910204-135910226 CTGGGTCAGGGTCAGGGTCAGGG + Intergenic
999194012 5:149769836-149769858 AAGGGTCAGGGTCAGGGTCAGGG - Intronic
1000938867 5:167336200-167336222 TCCGGTCAGGGTAAGGGTCTAGG + Intronic
1001387598 5:171352846-171352868 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1001645266 5:173276691-173276713 GACTGTCAGGGTGAGGGGCAAGG + Intergenic
1002000678 5:176194854-176194876 GCCAGGCAGGGGCAGGGGCAGGG + Intergenic
1002253661 5:177944127-177944149 GCCAGGCAGGGGCAGGGGCAGGG - Intergenic
1002792969 6:449122-449144 GCCCGCCAGCGCCAGGCTCAGGG - Intergenic
1002851108 6:997212-997234 GCCAGTAAGGATCAGGGACAGGG + Intergenic
1004133205 6:12941104-12941126 ACCAGTGAGGCTCAGGGTCAAGG + Intronic
1005859078 6:29887804-29887826 CCAGGTCTGGGTCAGGGTCAGGG - Intergenic
1006359410 6:33579031-33579053 GCCGGACAGGGACAGGGTGAAGG + Intronic
1006470125 6:34224027-34224049 GCCCGGCAGGGGCGGGGCCACGG - Intergenic
1007396718 6:41582198-41582220 TCCCTTCCGGGTCAGGGTCAGGG + Intronic
1007916974 6:45570078-45570100 TCCCTTCATAGTCAGGGTCAAGG + Intronic
1014290372 6:119551287-119551309 GCCCTTCAGGGTCTGGCTCCTGG + Intergenic
1016981424 6:149858198-149858220 GCCTGTCGGGGTGGGGGTCAAGG - Intronic
1024202535 7:47121549-47121571 GCGCCTCAGGGTCAAGGTTAGGG + Intergenic
1024220319 7:47281924-47281946 CAGGGTCAGGGTCAGGGTCAGGG - Intronic
1025769918 7:64495051-64495073 GCCCGTCAGCCTCAGGCCCAGGG - Intergenic
1025871226 7:65436062-65436084 GCCAGTCAGGGTCCAGGTCATGG - Intergenic
1027269902 7:76513468-76513490 GGAGGTCAGGGTCAGGGTCGGGG + Intronic
1029497309 7:100902901-100902923 GCCCAGCAGGGCCAGGGTCGGGG + Intergenic
1032508859 7:132455990-132456012 GCCCATCAGGGCCAGAGACAAGG - Intronic
1034427693 7:151023303-151023325 GCTCAGCAGGGGCAGGGTCAGGG - Intronic
1036470035 8:9044823-9044845 GCAGGTCAGGGTGAGAGTCAAGG - Intronic
1037541010 8:19871384-19871406 GTGGGTTAGGGTCAGGGTCAGGG + Intergenic
1038027693 8:23606785-23606807 ACCCATCAGGGTCAGGGGCATGG - Intergenic
1040420828 8:47239113-47239135 GAGGGTCAGGCTCAGGGTCATGG + Intergenic
1041576668 8:59405092-59405114 CCCAGTCAGGGACTGGGTCAGGG + Intergenic
1041682189 8:60605048-60605070 GTAGGTCAGGGCCAGGGTCAGGG + Intronic
1041906541 8:63039010-63039032 GCCCGTGGGGGTCGGGGTCGCGG - Exonic
1046217559 8:111169284-111169306 GACTGTCAAGGTGAGGGTCAGGG + Intergenic
1047203811 8:122787584-122787606 TCCTGTCAAGTTCAGGGTCAGGG + Intronic
1047959771 8:130002685-130002707 GCCCCTCAAAGTCAGGGCCATGG - Intronic
1049528489 8:143141791-143141813 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1049528491 8:143141797-143141819 CAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1053167082 9:35852589-35852611 GAAGCTCAGGGTCAGGGTCAGGG + Intronic
1053475031 9:38376534-38376556 CGGGGTCAGGGTCAGGGTCAGGG + Intergenic
1053691454 9:40589289-40589311 GCATTTCAGGGTCAGGGCCATGG - Intergenic
1053691730 9:40590202-40590224 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1053692427 9:40593068-40593090 GATTGTCAGGGTCAGGGTCAAGG - Intergenic
1054272389 9:63044465-63044487 GATTGTCAGGGTCAGGGTCAAGG + Intergenic
1054273349 9:63048196-63048218 GCATTTCAGGGTCAGGGCCATGG + Intergenic
1054302712 9:63390255-63390277 GCATTTCAGGGTCAGGGCCATGG - Intergenic
1054302986 9:63391168-63391190 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1054303669 9:63393986-63394008 GATTGTCAGGGTCAGGGTCAAGG - Intergenic
1054401486 9:64716760-64716782 GCATTTCAGGGTCAGGGCCATGG - Intergenic
1054402447 9:64720496-64720518 GATTGTCAGGGTCAGGGTCAAGG - Intergenic
1054435094 9:65201080-65201102 GCATTTCAGGGTCAGGGCCATGG - Intergenic
1054435371 9:65201993-65202015 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1054436057 9:65204827-65204849 GATTGTCAGGGTCAGGGTCAAGG - Intergenic
1054494335 9:65816860-65816882 GATTGTCAGGGTCAGGGTCAAGG + Intergenic
1054495296 9:65820601-65820623 GCATTTCAGGGTCAGGGCCATGG + Intergenic
1056719614 9:89060536-89060558 GCTTGGCACGGTCAGGGTCAAGG + Intronic
1056969904 9:91193229-91193251 GCCCGTAGGGGGCAGGGTGAGGG + Intergenic
1057191016 9:93087723-93087745 GCAGGTCAGGGTCAGGGCCTGGG + Intergenic
1059425856 9:114220531-114220553 GCCTGGCTGGGTCAGGCTCAGGG - Intronic
1061423195 9:130483416-130483438 GGCGCTCAGGGTCAGGGACAGGG + Intronic
1061482706 9:130904830-130904852 GCCCTCTGGGGTCAGGGTCAAGG - Intronic
1061883189 9:133578167-133578189 GCTCGTCAGGGGCAGAGCCATGG - Intergenic
1061999916 9:134210757-134210779 GCCCTTCAGCGCCAGGGCCATGG - Intergenic
1062452983 9:136623290-136623312 GCCCCTCAGGGTCAGGGTTCAGG + Intergenic
1203622133 Un_KI270749v1:135480-135502 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1203623069 Un_KI270749v1:139134-139156 GATTGTCAGGGCCAGGGTCAGGG - Intergenic
1189262347 X:39687796-39687818 GACAGTCAGGGTAGGGGTCAGGG - Intergenic
1190058777 X:47197705-47197727 GCCTTGCTGGGTCAGGGTCATGG + Intronic
1191025256 X:55907542-55907564 GATGGTCAGGATCAGGGTCAGGG + Intergenic
1195252935 X:103065514-103065536 GACAGTCAGGGTGAGGGTCTCGG - Intergenic
1195361792 X:104089338-104089360 TCCTGTCATGGTCATGGTCATGG + Intergenic
1197098471 X:122623393-122623415 GCCAGTCAGGGTCAGGTCCTAGG - Intergenic
1198161915 X:134016508-134016530 GCCAGTCAGGGTCCAGGTCATGG + Intergenic
1198239192 X:134766465-134766487 GGCCATCAGGGTCAGAGCCAAGG + Intergenic
1199489343 X:148381281-148381303 GCCAGTGAGTGACAGGGTCAGGG + Intergenic
1200400840 X:156019861-156019883 AAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1200400841 X:156019867-156019889 CAGGGTCAGGGTCAGGGTCAAGG + Intergenic
1200400859 X:156019917-156019939 GAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1200400865 X:156019941-156019963 GAGGGTCAGGGTCAGAGTCAGGG + Intergenic
1200400875 X:156019971-156019993 GAGGGTCAGGGTCAGGGTCAGGG + Intergenic
1200400923 X:156020105-156020127 CCGGGTCAGGGTTAGGGTCAGGG + Intergenic
1201190146 Y:11437961-11437983 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1201190424 Y:11438928-11438950 CCACTTCAGGGCCAGGGTCAGGG - Intergenic
1202583186 Y:26402959-26402981 CCACTTCAGGGCCAGGGTCAGGG + Intergenic
1202583482 Y:26403966-26403988 GCATTTCAGGGTCAGGGCCAGGG + Intergenic