ID: 938054962

View in Genome Browser
Species Human (GRCh38)
Location 2:128208082-128208104
Sequence CAGGCCGCACAGCAGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938054962_938054969 7 Left 938054962 2:128208082-128208104 CCCCGCTCCTGCTGTGCGGCCTG No data
Right 938054969 2:128208112-128208134 ACAGGCCAGAGACCCGTACCCGG No data
938054962_938054972 19 Left 938054962 2:128208082-128208104 CCCCGCTCCTGCTGTGCGGCCTG No data
Right 938054972 2:128208124-128208146 CCCGTACCCGGCCACAGCCCCGG No data
938054962_938054976 25 Left 938054962 2:128208082-128208104 CCCCGCTCCTGCTGTGCGGCCTG No data
Right 938054976 2:128208130-128208152 CCCGGCCACAGCCCCGGGCTCGG No data
938054962_938054974 20 Left 938054962 2:128208082-128208104 CCCCGCTCCTGCTGTGCGGCCTG No data
Right 938054974 2:128208125-128208147 CCGTACCCGGCCACAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938054962 Original CRISPR CAGGCCGCACAGCAGGAGCG GGG (reversed) Intergenic
No off target data available for this crispr