ID: 938056973

View in Genome Browser
Species Human (GRCh38)
Location 2:128223119-128223141
Sequence CAGAGAGAATAGATGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938056970_938056973 5 Left 938056970 2:128223091-128223113 CCGACGAAGCCTTACAGGTAGCA No data
Right 938056973 2:128223119-128223141 CAGAGAGAATAGATGGTAAATGG No data
938056968_938056973 15 Left 938056968 2:128223081-128223103 CCTTGTTATGCCGACGAAGCCTT No data
Right 938056973 2:128223119-128223141 CAGAGAGAATAGATGGTAAATGG No data
938056971_938056973 -4 Left 938056971 2:128223100-128223122 CCTTACAGGTAGCAGAACTCAGA No data
Right 938056973 2:128223119-128223141 CAGAGAGAATAGATGGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938056973 Original CRISPR CAGAGAGAATAGATGGTAAA TGG Intergenic
No off target data available for this crispr