ID: 938058926

View in Genome Browser
Species Human (GRCh38)
Location 2:128237295-128237317
Sequence ATGAATATACAAACAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938058923_938058926 9 Left 938058923 2:128237263-128237285 CCTTGATTTGAACCTTCCTGGTG No data
Right 938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG No data
938058925_938058926 -7 Left 938058925 2:128237279-128237301 CCTGGTGAGCGATTGAATGAATA No data
Right 938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG No data
938058924_938058926 -3 Left 938058924 2:128237275-128237297 CCTTCCTGGTGAGCGATTGAATG No data
Right 938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938058926 Original CRISPR ATGAATATACAAACAGACAA TGG Intronic
No off target data available for this crispr