ID: 938061831

View in Genome Browser
Species Human (GRCh38)
Location 2:128261013-128261035
Sequence GAATGCTTCTTTGTTCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938061831_938061839 23 Left 938061831 2:128261013-128261035 CCGCAGGGAACAAAGAAGCATTC No data
Right 938061839 2:128261059-128261081 AGGCTGACTCCCTGGAGTCTTGG No data
938061831_938061837 15 Left 938061831 2:128261013-128261035 CCGCAGGGAACAAAGAAGCATTC No data
Right 938061837 2:128261051-128261073 ACGGCTCCAGGCTGACTCCCTGG No data
938061831_938061840 28 Left 938061831 2:128261013-128261035 CCGCAGGGAACAAAGAAGCATTC No data
Right 938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG No data
938061831_938061834 3 Left 938061831 2:128261013-128261035 CCGCAGGGAACAAAGAAGCATTC No data
Right 938061834 2:128261039-128261061 AGCCTGAGCCACACGGCTCCAGG No data
938061831_938061832 -4 Left 938061831 2:128261013-128261035 CCGCAGGGAACAAAGAAGCATTC No data
Right 938061832 2:128261032-128261054 ATTCCTGAGCCTGAGCCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938061831 Original CRISPR GAATGCTTCTTTGTTCCCTG CGG (reversed) Intronic
No off target data available for this crispr