ID: 938061835

View in Genome Browser
Species Human (GRCh38)
Location 2:128261041-128261063
Sequence AGCCTGGAGCCGTGTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938061835_938061839 -5 Left 938061835 2:128261041-128261063 CCTGAGCCACACGGCTCCAGGCT No data
Right 938061839 2:128261059-128261081 AGGCTGACTCCCTGGAGTCTTGG No data
938061835_938061840 0 Left 938061835 2:128261041-128261063 CCTGAGCCACACGGCTCCAGGCT No data
Right 938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG No data
938061835_938061843 18 Left 938061835 2:128261041-128261063 CCTGAGCCACACGGCTCCAGGCT No data
Right 938061843 2:128261082-128261104 AGAGGCTTGTCTTGAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938061835 Original CRISPR AGCCTGGAGCCGTGTGGCTC AGG (reversed) Intronic
No off target data available for this crispr