ID: 938061836

View in Genome Browser
Species Human (GRCh38)
Location 2:128261047-128261069
Sequence GGAGTCAGCCTGGAGCCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938061836_938061840 -6 Left 938061836 2:128261047-128261069 CCACACGGCTCCAGGCTGACTCC No data
Right 938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG No data
938061836_938061843 12 Left 938061836 2:128261047-128261069 CCACACGGCTCCAGGCTGACTCC No data
Right 938061843 2:128261082-128261104 AGAGGCTTGTCTTGAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938061836 Original CRISPR GGAGTCAGCCTGGAGCCGTG TGG (reversed) Intronic
No off target data available for this crispr