ID: 938061840

View in Genome Browser
Species Human (GRCh38)
Location 2:128261064-128261086
Sequence GACTCCCTGGAGTCTTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938061831_938061840 28 Left 938061831 2:128261013-128261035 CCGCAGGGAACAAAGAAGCATTC No data
Right 938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG No data
938061833_938061840 6 Left 938061833 2:128261035-128261057 CCTGAGCCTGAGCCACACGGCTC No data
Right 938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG No data
938061835_938061840 0 Left 938061835 2:128261041-128261063 CCTGAGCCACACGGCTCCAGGCT No data
Right 938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG No data
938061836_938061840 -6 Left 938061836 2:128261047-128261069 CCACACGGCTCCAGGCTGACTCC No data
Right 938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938061840 Original CRISPR GACTCCCTGGAGTCTTGGAG AGG Intronic
No off target data available for this crispr