ID: 938065165

View in Genome Browser
Species Human (GRCh38)
Location 2:128278083-128278105
Sequence GTACCTGCAGGATTTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938065165_938065172 12 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065172 2:128278118-128278140 CTGAGTGCCTTCCAGGCAGGAGG No data
938065165_938065178 22 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065178 2:128278128-128278150 TCCAGGCAGGAGGGCGGGGCAGG No data
938065165_938065180 26 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065180 2:128278132-128278154 GGCAGGAGGGCGGGGCAGGCAGG No data
938065165_938065171 9 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065171 2:128278115-128278137 GCTCTGAGTGCCTTCCAGGCAGG No data
938065165_938065173 13 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065173 2:128278119-128278141 TGAGTGCCTTCCAGGCAGGAGGG No data
938065165_938065176 18 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065176 2:128278124-128278146 GCCTTCCAGGCAGGAGGGCGGGG No data
938065165_938065175 17 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065175 2:128278123-128278145 TGCCTTCCAGGCAGGAGGGCGGG No data
938065165_938065174 16 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065174 2:128278122-128278144 GTGCCTTCCAGGCAGGAGGGCGG No data
938065165_938065170 5 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065170 2:128278111-128278133 ATGAGCTCTGAGTGCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938065165 Original CRISPR GTACCTGCAGGATTTTCCCT GGG (reversed) Intronic