ID: 938065171

View in Genome Browser
Species Human (GRCh38)
Location 2:128278115-128278137
Sequence GCTCTGAGTGCCTTCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938065159_938065171 29 Left 938065159 2:128278063-128278085 CCCACTCAAACATACAGCACCCC No data
Right 938065171 2:128278115-128278137 GCTCTGAGTGCCTTCCAGGCAGG No data
938065158_938065171 30 Left 938065158 2:128278062-128278084 CCCCACTCAAACATACAGCACCC No data
Right 938065171 2:128278115-128278137 GCTCTGAGTGCCTTCCAGGCAGG No data
938065167_938065171 -3 Left 938065167 2:128278095-128278117 CCTGCAGGTACAGCCCATGAGCT No data
Right 938065171 2:128278115-128278137 GCTCTGAGTGCCTTCCAGGCAGG No data
938065164_938065171 10 Left 938065164 2:128278082-128278104 CCCCAGGGAAAATCCTGCAGGTA No data
Right 938065171 2:128278115-128278137 GCTCTGAGTGCCTTCCAGGCAGG No data
938065160_938065171 28 Left 938065160 2:128278064-128278086 CCACTCAAACATACAGCACCCCA No data
Right 938065171 2:128278115-128278137 GCTCTGAGTGCCTTCCAGGCAGG No data
938065166_938065171 8 Left 938065166 2:128278084-128278106 CCAGGGAAAATCCTGCAGGTACA No data
Right 938065171 2:128278115-128278137 GCTCTGAGTGCCTTCCAGGCAGG No data
938065165_938065171 9 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065171 2:128278115-128278137 GCTCTGAGTGCCTTCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938065171 Original CRISPR GCTCTGAGTGCCTTCCAGGC AGG Intronic