ID: 938065172

View in Genome Browser
Species Human (GRCh38)
Location 2:128278118-128278140
Sequence CTGAGTGCCTTCCAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938065166_938065172 11 Left 938065166 2:128278084-128278106 CCAGGGAAAATCCTGCAGGTACA No data
Right 938065172 2:128278118-128278140 CTGAGTGCCTTCCAGGCAGGAGG No data
938065167_938065172 0 Left 938065167 2:128278095-128278117 CCTGCAGGTACAGCCCATGAGCT No data
Right 938065172 2:128278118-128278140 CTGAGTGCCTTCCAGGCAGGAGG No data
938065165_938065172 12 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065172 2:128278118-128278140 CTGAGTGCCTTCCAGGCAGGAGG No data
938065164_938065172 13 Left 938065164 2:128278082-128278104 CCCCAGGGAAAATCCTGCAGGTA No data
Right 938065172 2:128278118-128278140 CTGAGTGCCTTCCAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938065172 Original CRISPR CTGAGTGCCTTCCAGGCAGG AGG Intronic