ID: 938065173

View in Genome Browser
Species Human (GRCh38)
Location 2:128278119-128278141
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938065166_938065173 12 Left 938065166 2:128278084-128278106 CCAGGGAAAATCCTGCAGGTACA No data
Right 938065173 2:128278119-128278141 TGAGTGCCTTCCAGGCAGGAGGG No data
938065164_938065173 14 Left 938065164 2:128278082-128278104 CCCCAGGGAAAATCCTGCAGGTA No data
Right 938065173 2:128278119-128278141 TGAGTGCCTTCCAGGCAGGAGGG No data
938065167_938065173 1 Left 938065167 2:128278095-128278117 CCTGCAGGTACAGCCCATGAGCT No data
Right 938065173 2:128278119-128278141 TGAGTGCCTTCCAGGCAGGAGGG No data
938065165_938065173 13 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065173 2:128278119-128278141 TGAGTGCCTTCCAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type