ID: 938065178

View in Genome Browser
Species Human (GRCh38)
Location 2:128278128-128278150
Sequence TCCAGGCAGGAGGGCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938065166_938065178 21 Left 938065166 2:128278084-128278106 CCAGGGAAAATCCTGCAGGTACA No data
Right 938065178 2:128278128-128278150 TCCAGGCAGGAGGGCGGGGCAGG No data
938065168_938065178 -3 Left 938065168 2:128278108-128278130 CCCATGAGCTCTGAGTGCCTTCC No data
Right 938065178 2:128278128-128278150 TCCAGGCAGGAGGGCGGGGCAGG No data
938065165_938065178 22 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065178 2:128278128-128278150 TCCAGGCAGGAGGGCGGGGCAGG No data
938065164_938065178 23 Left 938065164 2:128278082-128278104 CCCCAGGGAAAATCCTGCAGGTA No data
Right 938065178 2:128278128-128278150 TCCAGGCAGGAGGGCGGGGCAGG No data
938065167_938065178 10 Left 938065167 2:128278095-128278117 CCTGCAGGTACAGCCCATGAGCT No data
Right 938065178 2:128278128-128278150 TCCAGGCAGGAGGGCGGGGCAGG No data
938065169_938065178 -4 Left 938065169 2:128278109-128278131 CCATGAGCTCTGAGTGCCTTCCA No data
Right 938065178 2:128278128-128278150 TCCAGGCAGGAGGGCGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938065178 Original CRISPR TCCAGGCAGGAGGGCGGGGC AGG Intronic