ID: 938065180

View in Genome Browser
Species Human (GRCh38)
Location 2:128278132-128278154
Sequence GGCAGGAGGGCGGGGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938065166_938065180 25 Left 938065166 2:128278084-128278106 CCAGGGAAAATCCTGCAGGTACA No data
Right 938065180 2:128278132-128278154 GGCAGGAGGGCGGGGCAGGCAGG No data
938065168_938065180 1 Left 938065168 2:128278108-128278130 CCCATGAGCTCTGAGTGCCTTCC No data
Right 938065180 2:128278132-128278154 GGCAGGAGGGCGGGGCAGGCAGG No data
938065167_938065180 14 Left 938065167 2:128278095-128278117 CCTGCAGGTACAGCCCATGAGCT No data
Right 938065180 2:128278132-128278154 GGCAGGAGGGCGGGGCAGGCAGG No data
938065164_938065180 27 Left 938065164 2:128278082-128278104 CCCCAGGGAAAATCCTGCAGGTA No data
Right 938065180 2:128278132-128278154 GGCAGGAGGGCGGGGCAGGCAGG No data
938065169_938065180 0 Left 938065169 2:128278109-128278131 CCATGAGCTCTGAGTGCCTTCCA No data
Right 938065180 2:128278132-128278154 GGCAGGAGGGCGGGGCAGGCAGG No data
938065165_938065180 26 Left 938065165 2:128278083-128278105 CCCAGGGAAAATCCTGCAGGTAC No data
Right 938065180 2:128278132-128278154 GGCAGGAGGGCGGGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938065180 Original CRISPR GGCAGGAGGGCGGGGCAGGC AGG Intronic