ID: 938066292

View in Genome Browser
Species Human (GRCh38)
Location 2:128283676-128283698
Sequence TGCCATCCCTATAATGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938066292_938066309 25 Left 938066292 2:128283676-128283698 CCTCCCCCATTATAGGGATGGCA No data
Right 938066309 2:128283724-128283746 GAGTGTGGGTCTACCCCTGTGGG No data
938066292_938066310 30 Left 938066292 2:128283676-128283698 CCTCCCCCATTATAGGGATGGCA No data
Right 938066310 2:128283729-128283751 TGGGTCTACCCCTGTGGGTGAGG No data
938066292_938066303 -4 Left 938066292 2:128283676-128283698 CCTCCCCCATTATAGGGATGGCA No data
Right 938066303 2:128283695-128283717 GGCAGGGGTGGGCTTTGGCCAGG No data
938066292_938066308 24 Left 938066292 2:128283676-128283698 CCTCCCCCATTATAGGGATGGCA No data
Right 938066308 2:128283723-128283745 GGAGTGTGGGTCTACCCCTGTGG No data
938066292_938066302 -9 Left 938066292 2:128283676-128283698 CCTCCCCCATTATAGGGATGGCA No data
Right 938066302 2:128283690-128283712 GGGATGGCAGGGGTGGGCTTTGG No data
938066292_938066304 3 Left 938066292 2:128283676-128283698 CCTCCCCCATTATAGGGATGGCA No data
Right 938066304 2:128283702-128283724 GTGGGCTTTGGCCAGGCTGCTGG No data
938066292_938066305 10 Left 938066292 2:128283676-128283698 CCTCCCCCATTATAGGGATGGCA No data
Right 938066305 2:128283709-128283731 TTGGCCAGGCTGCTGGAGTGTGG No data
938066292_938066306 11 Left 938066292 2:128283676-128283698 CCTCCCCCATTATAGGGATGGCA No data
Right 938066306 2:128283710-128283732 TGGCCAGGCTGCTGGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938066292 Original CRISPR TGCCATCCCTATAATGGGGG AGG (reversed) Intronic
No off target data available for this crispr