ID: 938068473

View in Genome Browser
Species Human (GRCh38)
Location 2:128294220-128294242
Sequence CCGGCCCTGGCACTGTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938068464_938068473 12 Left 938068464 2:128294185-128294207 CCCCACATGGCTCTTCTGTCATA No data
Right 938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG No data
938068466_938068473 10 Left 938068466 2:128294187-128294209 CCACATGGCTCTTCTGTCATACA No data
Right 938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG No data
938068463_938068473 19 Left 938068463 2:128294178-128294200 CCTGAGACCCCACATGGCTCTTC No data
Right 938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG No data
938068462_938068473 22 Left 938068462 2:128294175-128294197 CCTCCTGAGACCCCACATGGCTC No data
Right 938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG No data
938068460_938068473 25 Left 938068460 2:128294172-128294194 CCTCCTCCTGAGACCCCACATGG No data
Right 938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG No data
938068465_938068473 11 Left 938068465 2:128294186-128294208 CCCACATGGCTCTTCTGTCATAC No data
Right 938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938068473 Original CRISPR CCGGCCCTGGCACTGTGCTC TGG Intronic
No off target data available for this crispr