ID: 938069987

View in Genome Browser
Species Human (GRCh38)
Location 2:128303211-128303233
Sequence GCACCTCTTGGCTGCATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938069987_938069992 10 Left 938069987 2:128303211-128303233 CCAAACATGCAGCCAAGAGGTGC No data
Right 938069992 2:128303244-128303266 CACAGAGGACAGTAAAGGCAGGG No data
938069987_938069989 -5 Left 938069987 2:128303211-128303233 CCAAACATGCAGCCAAGAGGTGC No data
Right 938069989 2:128303229-128303251 GGTGCTTTGCAGCATCACAGAGG No data
938069987_938069991 9 Left 938069987 2:128303211-128303233 CCAAACATGCAGCCAAGAGGTGC No data
Right 938069991 2:128303243-128303265 TCACAGAGGACAGTAAAGGCAGG No data
938069987_938069993 15 Left 938069987 2:128303211-128303233 CCAAACATGCAGCCAAGAGGTGC No data
Right 938069993 2:128303249-128303271 AGGACAGTAAAGGCAGGGCCAGG No data
938069987_938069990 5 Left 938069987 2:128303211-128303233 CCAAACATGCAGCCAAGAGGTGC No data
Right 938069990 2:128303239-128303261 AGCATCACAGAGGACAGTAAAGG No data
938069987_938069994 18 Left 938069987 2:128303211-128303233 CCAAACATGCAGCCAAGAGGTGC No data
Right 938069994 2:128303252-128303274 ACAGTAAAGGCAGGGCCAGGAGG No data
938069987_938069995 19 Left 938069987 2:128303211-128303233 CCAAACATGCAGCCAAGAGGTGC No data
Right 938069995 2:128303253-128303275 CAGTAAAGGCAGGGCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938069987 Original CRISPR GCACCTCTTGGCTGCATGTT TGG (reversed) Intronic
No off target data available for this crispr