ID: 938069988

View in Genome Browser
Species Human (GRCh38)
Location 2:128303223-128303245
Sequence TGATGCTGCAAAGCACCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938069988_938069992 -2 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069992 2:128303244-128303266 CACAGAGGACAGTAAAGGCAGGG No data
938069988_938069997 24 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069997 2:128303270-128303292 GGAGGGCATGTGAAGTGCTCAGG No data
938069988_938069991 -3 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069991 2:128303243-128303265 TCACAGAGGACAGTAAAGGCAGG No data
938069988_938069998 25 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069998 2:128303271-128303293 GAGGGCATGTGAAGTGCTCAGGG No data
938069988_938069990 -7 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069990 2:128303239-128303261 AGCATCACAGAGGACAGTAAAGG No data
938069988_938069995 7 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069995 2:128303253-128303275 CAGTAAAGGCAGGGCCAGGAGGG No data
938069988_938069993 3 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069993 2:128303249-128303271 AGGACAGTAAAGGCAGGGCCAGG No data
938069988_938069994 6 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069994 2:128303252-128303274 ACAGTAAAGGCAGGGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938069988 Original CRISPR TGATGCTGCAAAGCACCTCT TGG (reversed) Intronic
No off target data available for this crispr