ID: 938069995

View in Genome Browser
Species Human (GRCh38)
Location 2:128303253-128303275
Sequence CAGTAAAGGCAGGGCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938069987_938069995 19 Left 938069987 2:128303211-128303233 CCAAACATGCAGCCAAGAGGTGC No data
Right 938069995 2:128303253-128303275 CAGTAAAGGCAGGGCCAGGAGGG No data
938069988_938069995 7 Left 938069988 2:128303223-128303245 CCAAGAGGTGCTTTGCAGCATCA No data
Right 938069995 2:128303253-128303275 CAGTAAAGGCAGGGCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938069995 Original CRISPR CAGTAAAGGCAGGGCCAGGA GGG Intronic
No off target data available for this crispr