ID: 938069995 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:128303253-128303275 |
| Sequence | CAGTAAAGGCAGGGCCAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938069987_938069995 | 19 | Left | 938069987 | 2:128303211-128303233 | CCAAACATGCAGCCAAGAGGTGC | No data | ||
| Right | 938069995 | 2:128303253-128303275 | CAGTAAAGGCAGGGCCAGGAGGG | No data | ||||
| 938069988_938069995 | 7 | Left | 938069988 | 2:128303223-128303245 | CCAAGAGGTGCTTTGCAGCATCA | No data | ||
| Right | 938069995 | 2:128303253-128303275 | CAGTAAAGGCAGGGCCAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938069995 | Original CRISPR | CAGTAAAGGCAGGGCCAGGA GGG | Intronic | ||
| No off target data available for this crispr | |||||