ID: 938070653

View in Genome Browser
Species Human (GRCh38)
Location 2:128306602-128306624
Sequence CTTTCTAATTCTCAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938070650_938070653 -7 Left 938070650 2:128306586-128306608 CCTGCAGCAGAAGGCGCTTTCTA No data
Right 938070653 2:128306602-128306624 CTTTCTAATTCTCAGGTGGATGG No data
938070646_938070653 25 Left 938070646 2:128306554-128306576 CCTAGGGGCTGTAAACATTTGTT No data
Right 938070653 2:128306602-128306624 CTTTCTAATTCTCAGGTGGATGG No data
938070645_938070653 28 Left 938070645 2:128306551-128306573 CCGCCTAGGGGCTGTAAACATTT No data
Right 938070653 2:128306602-128306624 CTTTCTAATTCTCAGGTGGATGG No data
938070647_938070653 2 Left 938070647 2:128306577-128306599 CCTGCAAGCCCTGCAGCAGAAGG No data
Right 938070653 2:128306602-128306624 CTTTCTAATTCTCAGGTGGATGG No data
938070649_938070653 -6 Left 938070649 2:128306585-128306607 CCCTGCAGCAGAAGGCGCTTTCT No data
Right 938070653 2:128306602-128306624 CTTTCTAATTCTCAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938070653 Original CRISPR CTTTCTAATTCTCAGGTGGA TGG Intronic
No off target data available for this crispr