ID: 938070662

View in Genome Browser
Species Human (GRCh38)
Location 2:128306645-128306667
Sequence TGCCATGCCCCCACTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938070662_938070669 -1 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070669 2:128306667-128306689 AGCAGGGGTACTGCAAATATGGG No data
938070662_938070673 6 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070673 2:128306674-128306696 GTACTGCAAATATGGGGCTGGGG No data
938070662_938070676 16 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070676 2:128306684-128306706 TATGGGGCTGGGGTCACATGGGG No data
938070662_938070675 15 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070675 2:128306683-128306705 ATATGGGGCTGGGGTCACATGGG No data
938070662_938070678 20 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070678 2:128306688-128306710 GGGCTGGGGTCACATGGGGTGGG No data
938070662_938070679 21 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070679 2:128306689-128306711 GGCTGGGGTCACATGGGGTGGGG No data
938070662_938070680 22 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070680 2:128306690-128306712 GCTGGGGTCACATGGGGTGGGGG No data
938070662_938070672 5 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070672 2:128306673-128306695 GGTACTGCAAATATGGGGCTGGG No data
938070662_938070670 0 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070670 2:128306668-128306690 GCAGGGGTACTGCAAATATGGGG No data
938070662_938070668 -2 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070668 2:128306666-128306688 CAGCAGGGGTACTGCAAATATGG No data
938070662_938070674 14 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070674 2:128306682-128306704 AATATGGGGCTGGGGTCACATGG No data
938070662_938070677 19 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070677 2:128306687-128306709 GGGGCTGGGGTCACATGGGGTGG No data
938070662_938070671 4 Left 938070662 2:128306645-128306667 CCCAAGCCAGTGGGGGCATGGCA No data
Right 938070671 2:128306672-128306694 GGGTACTGCAAATATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938070662 Original CRISPR TGCCATGCCCCCACTGGCTT GGG (reversed) Intronic
No off target data available for this crispr