ID: 938070834

View in Genome Browser
Species Human (GRCh38)
Location 2:128307340-128307362
Sequence CACCACCAGCAGGGTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938070824_938070834 22 Left 938070824 2:128307295-128307317 CCATCTGTCCACCTGCTCACACT No data
Right 938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG No data
938070830_938070834 -10 Left 938070830 2:128307327-128307349 CCAGCTGAGCTCTCACCACCAGC No data
Right 938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG No data
938070827_938070834 -7 Left 938070827 2:128307324-128307346 CCCCCAGCTGAGCTCTCACCACC No data
Right 938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG No data
938070829_938070834 -9 Left 938070829 2:128307326-128307348 CCCAGCTGAGCTCTCACCACCAG No data
Right 938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG No data
938070825_938070834 14 Left 938070825 2:128307303-128307325 CCACCTGCTCACACTAACAAGCC No data
Right 938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG No data
938070826_938070834 11 Left 938070826 2:128307306-128307328 CCTGCTCACACTAACAAGCCCCC No data
Right 938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG No data
938070828_938070834 -8 Left 938070828 2:128307325-128307347 CCCCAGCTGAGCTCTCACCACCA No data
Right 938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938070834 Original CRISPR CACCACCAGCAGGGTCCCAT GGG Intronic
No off target data available for this crispr