ID: 938073297

View in Genome Browser
Species Human (GRCh38)
Location 2:128319246-128319268
Sequence CTTTCCTCCCGCGCGGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938073297_938073301 -3 Left 938073297 2:128319246-128319268 CCGCAGCCCGCGCGGGAGGAAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 938073301 2:128319266-128319288 AAGGCCTTGACCTTGCACGCTGG 0: 1
1: 0
2: 0
3: 8
4: 77
938073297_938073306 26 Left 938073297 2:128319246-128319268 CCGCAGCCCGCGCGGGAGGAAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 938073306 2:128319295-128319317 GAAGTTAGACGCTAGCCTACTGG 0: 1
1: 0
2: 0
3: 0
4: 33
938073297_938073303 -1 Left 938073297 2:128319246-128319268 CCGCAGCCCGCGCGGGAGGAAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 938073303 2:128319268-128319290 GGCCTTGACCTTGCACGCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 132
938073297_938073302 -2 Left 938073297 2:128319246-128319268 CCGCAGCCCGCGCGGGAGGAAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 938073302 2:128319267-128319289 AGGCCTTGACCTTGCACGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 95
938073297_938073307 27 Left 938073297 2:128319246-128319268 CCGCAGCCCGCGCGGGAGGAAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 938073307 2:128319296-128319318 AAGTTAGACGCTAGCCTACTGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938073297 Original CRISPR CTTTCCTCCCGCGCGGGCTG CGG (reversed) Intergenic
903601703 1:24546704-24546726 CTTTCCACCAGCGAGGGCAGAGG - Intergenic
903792604 1:25905613-25905635 CTTCCCACGCGCGCGGGCTCCGG - Intronic
904081011 1:27872618-27872640 CCTCCCTCCCGCGCGTGCTGCGG + Exonic
905026771 1:34855838-34855860 TTTTCCTCCTCCACGGGCTGGGG + Exonic
906069865 1:43008567-43008589 CTTTCTTCCACCGCGTGCTGTGG + Intergenic
906087538 1:43148644-43148666 CTTTCCTCCTGCTGGGTCTGAGG - Intronic
906243485 1:44257079-44257101 CTTTCCTCCCCGGGGTGCTGGGG + Intronic
906680002 1:47720055-47720077 CTTTCCTCCCACATGGGCAGGGG - Intergenic
915635272 1:157181913-157181935 CCTTCCTCCCTTGAGGGCTGAGG - Intergenic
915660867 1:157403867-157403889 CCTTCCTCCCTCAAGGGCTGAGG - Intergenic
915661884 1:157411554-157411576 CTTCCCTACCGTGGGGGCTGAGG + Intergenic
919726339 1:200887265-200887287 GTTTCCTTCCCCGCGGGCGGTGG - Intergenic
919921091 1:202166897-202166919 CTTTCCTCCCTGGAGAGCTGAGG + Intergenic
920331456 1:205211324-205211346 CTCTCCTCCCTCACGGGCGGCGG - Exonic
922287695 1:224183810-224183832 CTCTCCTCCGGAGCGGGCCGAGG + Intronic
922919854 1:229293322-229293344 CTTTCCTCCCCAGAGGGCTGAGG + Intronic
924775166 1:247111346-247111368 CTCTCCACCCCCGCGCGCTGGGG - Exonic
1069995300 10:72338300-72338322 CTTCCCTCCAGGGCGGGCTAGGG - Exonic
1074085803 10:110208306-110208328 CTGTCCTCTCCGGCGGGCTGGGG + Intronic
1074577541 10:114684511-114684533 CATTCTTCCTGCGCTGGCTGTGG - Intronic
1076358200 10:129867991-129868013 CTCTCCTCCCGCGGTGGCCGCGG - Intronic
1077051317 11:568281-568303 CCGCCCTCCCGCGGGGGCTGCGG - Intergenic
1077139990 11:1020085-1020107 CTTACCTCCCGAGGAGGCTGTGG + Exonic
1079166217 11:18046051-18046073 CTTTCCTCCCACGCTGTTTGGGG - Intergenic
1089304921 11:117520646-117520668 CGATCCTCCCGCCTGGGCTGAGG - Intronic
1090977338 11:131689089-131689111 CCTTCCTTCCTCGGGGGCTGCGG - Intronic
1091223661 11:133945489-133945511 CCCTCCTCTCCCGCGGGCTGGGG + Intronic
1093266899 12:17015076-17015098 CTTTCCTCCCGGCCTGGCAGAGG - Intergenic
1096590728 12:52657565-52657587 CTTTCCTCCCCTGTGGACTGAGG + Intergenic
1098893313 12:76031361-76031383 GTTTCCAGCCGCGCGGGCCGGGG + Exonic
1101371873 12:104137993-104138015 CCGCCCTCCCGCGCGGGCCGAGG - Intronic
1101692180 12:107093049-107093071 CTTTCCTCACGCCCCGGGTGAGG - Exonic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1112054369 13:95677024-95677046 CTTTCCTCCCGGGCTCGCCGGGG - Intergenic
1118305213 14:64649820-64649842 CTATCCTCCCCAGGGGGCTGAGG - Intergenic
1119296553 14:73537804-73537826 ACTTCCTCCCGCCCGGGGTGCGG + Exonic
1119300795 14:73569809-73569831 ACTTCCTCCCGCCCGGGGTGCGG + Exonic
1120996825 14:90423740-90423762 CTTTCCTGCCGCTCTGGCTCAGG + Intergenic
1122271238 14:100569196-100569218 CCTTCCGCACCCGCGGGCTGCGG + Intronic
1122486614 14:102086636-102086658 GTGCCCTCCCGCGCGGGCTGCGG + Intronic
1125535691 15:40440488-40440510 GTTTTCTCCAGCGCGTGCTGGGG + Intronic
1128324576 15:66715965-66715987 CCTCCCTCCCGCTAGGGCTGGGG - Intronic
1128752087 15:70156913-70156935 CCTTCCTCCCGAGCCGTCTGTGG + Intergenic
1132086480 15:98912253-98912275 CTTTCCTCCTGCCAGAGCTGGGG + Intronic
1132719853 16:1310095-1310117 CCTTCCTCCTGCGCGGGGAGCGG + Intronic
1136544632 16:30948438-30948460 CCTTCCTCGAGCGCGGGGTGGGG + Exonic
1139422465 16:66857028-66857050 CTTCCCTCCAGTGCAGGCTGTGG + Intronic
1143773993 17:9185973-9185995 CTTCCCTCCCTGGCTGGCTGTGG + Intronic
1150868014 17:68875260-68875282 CTTTCCTGCCGAGCAGCCTGGGG + Exonic
1151924669 17:77186259-77186281 CTTCCCTCCCCTGGGGGCTGTGG + Intronic
1152230123 17:79110202-79110224 CTTCCCTCCCGACTGGGCTGGGG + Intronic
1152403868 17:80085521-80085543 ATTTCCTCCAGCGGGGTCTGTGG + Intronic
1152648460 17:81481243-81481265 CTTCCCTCCCGCGTGGGCAGGGG + Intergenic
1152749819 17:82057484-82057506 CTTTCCTGCCGTGCAGGCTCTGG + Intronic
1153997329 18:10454224-10454246 CTTTCCTTGCGGGCGGGGTGCGG + Intergenic
1155054027 18:22169809-22169831 CCTTCCCTCCGGGCGGGCTGAGG + Intronic
1156460726 18:37319964-37319986 CCTTCCCCCCGCCAGGGCTGGGG - Intronic
1160934115 19:1585198-1585220 ACTTCTTCCCGCTCGGGCTGCGG + Exonic
1161255594 19:3307460-3307482 CTTTACTCCAGCGGGGGCTCCGG + Intergenic
1162426891 19:10602468-10602490 CCTCCCGCCCGCCCGGGCTGGGG + Intronic
1162626308 19:11887825-11887847 CTTTGTCCCTGCGCGGGCTGCGG + Intronic
1163155267 19:15436830-15436852 CTTTCCACCCACCTGGGCTGAGG - Exonic
1164531983 19:29055769-29055791 CTGTACTCCAGCGTGGGCTGAGG - Intergenic
1164713331 19:30374856-30374878 CTGGCCCCCCGCCCGGGCTGGGG + Intronic
1164839353 19:31380865-31380887 CTTTCCTCCCGCACCGCCTTTGG - Intergenic
1166856497 19:45784979-45785001 CTTGCCTCCTGGGTGGGCTGTGG - Intronic
926205165 2:10830517-10830539 CTTTCCTCCCTGGCGGCCTGGGG + Intronic
929439671 2:41955261-41955283 GTTTCCTCCTGCCCGGGCAGTGG + Intergenic
932213182 2:69948620-69948642 CTTTCCTCCAGGGCGAGCTGCGG - Intergenic
935097673 2:99961377-99961399 CTTTCCTCCCTCGGGGGCCCCGG + Intronic
936885682 2:117308287-117308309 CTTTCCTCCCGCCCTAGCAGGGG - Intergenic
937853425 2:126656118-126656140 CACTCCTCCCGCGCGGGCCGAGG - Exonic
938073297 2:128319246-128319268 CTTTCCTCCCGCGCGGGCTGCGG - Intergenic
1168971968 20:1937431-1937453 GTGTCCTCCGACGCGGGCTGCGG - Exonic
1173021825 20:39273715-39273737 CTTTCTTCCTGCTCGGGCTTGGG + Intergenic
1176109350 20:63404409-63404431 CTTTCCTCCCCCGCCAGGTGTGG - Intergenic
1181026982 22:20132194-20132216 CTCTCCACCCGCTGGGGCTGGGG + Intronic
1184757399 22:46524820-46524842 GTTTCCTCCCACACGTGCTGAGG - Intronic
1185140057 22:49095158-49095180 CATTCCTCCCCAGCGGGCAGAGG + Intergenic
1185252110 22:49808508-49808530 CATTCCTCCCTCCCTGGCTGCGG - Intronic
950329822 3:12147418-12147440 CTTTCCTTCTGCGTGGCCTGAGG + Intronic
953257658 3:41306196-41306218 CCTCCCTCCCGGGCGGGGTGGGG - Intronic
954642566 3:52110202-52110224 CTTTTCTCCCTGGAGGGCTGGGG - Intronic
962895309 3:139708677-139708699 GTTTCCTCCCACCCAGGCTGTGG + Intergenic
964007724 3:151851854-151851876 CTTTCCTCCCGCTAGTTCTGAGG - Intergenic
967880265 3:194296944-194296966 CTTTCCAGCCGCGCGGCCCGGGG - Intergenic
968908870 4:3466622-3466644 CTGTCCTGACGCGGGGGCTGAGG - Intronic
977848124 4:101790739-101790761 CTTGCCACCCGCGGAGGCTGCGG - Exonic
981067226 4:140498079-140498101 CTTTCCCGCCGCGGGGGCTTCGG - Intronic
985067948 4:186142002-186142024 CTTTCCTCCAGGGAAGGCTGGGG - Intronic
985122774 4:186660608-186660630 CTGTGCTCCCGCCGGGGCTGGGG + Intronic
985671967 5:1211275-1211297 CTTTCCTGCCTCCGGGGCTGTGG + Intronic
985848353 5:2370839-2370861 CATTCCTCCCGCAAGGCCTGCGG - Intergenic
991298182 5:65103067-65103089 CTCTCCTCCCGCTCGGGCCCGGG - Intergenic
1001438913 5:171723217-171723239 CTTTCCTCCCGAGGGTGCTGAGG - Intergenic
1002148332 5:177204804-177204826 TTTTCCTCCCCAGTGGGCTGGGG + Intronic
1003569955 6:7249145-7249167 GTGGCCTCCCGCGCAGGCTGCGG - Exonic
1007479795 6:42142449-42142471 CCTGGCGCCCGCGCGGGCTGCGG - Intronic
1013115812 6:107102961-107102983 ATTTCCTCCCTGGCTGGCTGAGG - Intronic
1019473079 7:1231498-1231520 CTTCCCTCTCACGCGGGCTAGGG + Intergenic
1022942481 7:35253982-35254004 CCTTCCTCCCTCTGGGGCTGGGG + Exonic
1023972399 7:45000561-45000583 CTTTCCTCTGGCCCGGGCAGCGG + Intronic
1024605611 7:51020273-51020295 CTTTCCTCCCAGGAGGGCAGCGG - Intronic
1030029338 7:105354379-105354401 TTTTCCTCCTGCACAGGCTGTGG + Intronic
1035254993 7:157620684-157620706 CTTTCCTCCAGCACGGGCCTGGG - Intronic
1038327782 8:26585647-26585669 CTCTCCTCCAGGGCGGACTGTGG + Intronic
1046131639 8:109974445-109974467 CTTTGGTCCCGCGAGGGCGGTGG + Exonic
1049377996 8:142298177-142298199 CTTTCCTCCCGCCCTGGCCCAGG + Intronic
1049419463 8:142510548-142510570 CCTCCTTCCCGCGCGGGCCGGGG + Intronic
1061238021 9:129353232-129353254 CCTCCCTCCCAAGCGGGCTGGGG + Intergenic
1188002355 X:24994630-24994652 CTCTCCTCAGGTGCGGGCTGGGG + Intronic
1189905360 X:45753746-45753768 CTTTCTTCCTGTGCGGGGTGGGG + Intergenic
1195315809 X:103676723-103676745 CTTTTCTTCCGAGGGGGCTGAGG + Exonic
1196425097 X:115561693-115561715 CTTCCCTCCCGCCCGGACTCAGG + Intronic