ID: 938076223

View in Genome Browser
Species Human (GRCh38)
Location 2:128340022-128340044
Sequence CTTCATATGGAGACACGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938076216_938076223 13 Left 938076216 2:128339986-128340008 CCCTGCTTGGAGGAACACTGGGA No data
Right 938076223 2:128340022-128340044 CTTCATATGGAGACACGGGAGGG No data
938076212_938076223 23 Left 938076212 2:128339976-128339998 CCTGGGAGCACCCTGCTTGGAGG No data
Right 938076223 2:128340022-128340044 CTTCATATGGAGACACGGGAGGG No data
938076217_938076223 12 Left 938076217 2:128339987-128340009 CCTGCTTGGAGGAACACTGGGAA No data
Right 938076223 2:128340022-128340044 CTTCATATGGAGACACGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938076223 Original CRISPR CTTCATATGGAGACACGGGA GGG Intergenic
No off target data available for this crispr